ID: 1117763505

View in Genome Browser
Species Human (GRCh38)
Location 14:59057797-59057819
Sequence CCAAGCTGGTAGACAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117763505_1117763509 0 Left 1117763505 14:59057797-59057819 CCAGTATCTGTCTACCAGCTTGG No data
Right 1117763509 14:59057820-59057842 GAGAGAAAGAAAGATCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117763505 Original CRISPR CCAAGCTGGTAGACAGATAC TGG (reversed) Intergenic
No off target data available for this crispr