ID: 1117767038

View in Genome Browser
Species Human (GRCh38)
Location 14:59093961-59093983
Sequence TGAGAAAGGTCCTGGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117767038_1117767043 11 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767043 14:59093995-59094017 GTTAATTAAATATTACCGCAGGG No data
1117767038_1117767045 16 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767045 14:59094000-59094022 TTAAATATTACCGCAGGGGCCGG No data
1117767038_1117767049 29 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767049 14:59094013-59094035 CAGGGGCCGGTCTGGAAGTAGGG No data
1117767038_1117767044 12 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767044 14:59093996-59094018 TTAATTAAATATTACCGCAGGGG No data
1117767038_1117767046 21 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767046 14:59094005-59094027 TATTACCGCAGGGGCCGGTCTGG No data
1117767038_1117767042 10 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767042 14:59093994-59094016 TGTTAATTAAATATTACCGCAGG No data
1117767038_1117767048 28 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767048 14:59094012-59094034 GCAGGGGCCGGTCTGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117767038 Original CRISPR TGAGAAAGGTCCTGGTTGTG TGG (reversed) Intergenic