ID: 1117767043

View in Genome Browser
Species Human (GRCh38)
Location 14:59093995-59094017
Sequence GTTAATTAAATATTACCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117767038_1117767043 11 Left 1117767038 14:59093961-59093983 CCACACAACCAGGACCTTTCTCA No data
Right 1117767043 14:59093995-59094017 GTTAATTAAATATTACCGCAGGG No data
1117767040_1117767043 -3 Left 1117767040 14:59093975-59093997 CCTTTCTCATCAATTGCCTTGTT No data
Right 1117767043 14:59093995-59094017 GTTAATTAAATATTACCGCAGGG No data
1117767039_1117767043 3 Left 1117767039 14:59093969-59093991 CCAGGACCTTTCTCATCAATTGC No data
Right 1117767043 14:59093995-59094017 GTTAATTAAATATTACCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117767043 Original CRISPR GTTAATTAAATATTACCGCA GGG Intergenic
No off target data available for this crispr