ID: 1117767520

View in Genome Browser
Species Human (GRCh38)
Location 14:59098344-59098366
Sequence TTGAAGACCTTGAATTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117767520_1117767521 -8 Left 1117767520 14:59098344-59098366 CCTCTATAATTCAAGGTCTTCAA No data
Right 1117767521 14:59098359-59098381 GTCTTCAACTTCTTCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117767520 Original CRISPR TTGAAGACCTTGAATTATAG AGG (reversed) Intergenic
No off target data available for this crispr