ID: 1117768510

View in Genome Browser
Species Human (GRCh38)
Location 14:59107986-59108008
Sequence ATACCACAGCTGATGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117768504_1117768510 -2 Left 1117768504 14:59107965-59107987 CCCCAACACCTGTTCCTCTCCAT No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768507_1117768510 -10 Left 1117768507 14:59107973-59107995 CCTGTTCCTCTCCATACCACAGC No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768506_1117768510 -4 Left 1117768506 14:59107967-59107989 CCAACACCTGTTCCTCTCCATAC No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768503_1117768510 -1 Left 1117768503 14:59107964-59107986 CCCCCAACACCTGTTCCTCTCCA No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768505_1117768510 -3 Left 1117768505 14:59107966-59107988 CCCAACACCTGTTCCTCTCCATA No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768500_1117768510 2 Left 1117768500 14:59107961-59107983 CCCCCCCCAACACCTGTTCCTCT No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768501_1117768510 1 Left 1117768501 14:59107962-59107984 CCCCCCCAACACCTGTTCCTCTC No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data
1117768502_1117768510 0 Left 1117768502 14:59107963-59107985 CCCCCCAACACCTGTTCCTCTCC No data
Right 1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117768510 Original CRISPR ATACCACAGCTGATGTTCTC TGG Intergenic
No off target data available for this crispr