ID: 1117769466

View in Genome Browser
Species Human (GRCh38)
Location 14:59118462-59118484
Sequence CTGAATTTACAAATTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117769466_1117769467 3 Left 1117769466 14:59118462-59118484 CCTTTCTAAATTTGTAAATTCAG No data
Right 1117769467 14:59118488-59118510 TTGCTTTTCTGTTAACAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117769466 Original CRISPR CTGAATTTACAAATTTAGAA AGG (reversed) Intergenic
No off target data available for this crispr