ID: 1117776496

View in Genome Browser
Species Human (GRCh38)
Location 14:59189231-59189253
Sequence GGCGGTGGCGACAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 559}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117776483_1117776496 14 Left 1117776483 14:59189194-59189216 CCGAGAGGGAGAACCCCGAGGCA 0: 1
1: 0
2: 1
3: 4
4: 136
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776489_1117776496 -1 Left 1117776489 14:59189209-59189231 CCGAGGCAGGCTTGGTGGACACG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776480_1117776496 24 Left 1117776480 14:59189184-59189206 CCCGGCGGCTCCGAGAGGGAGAA 0: 1
1: 0
2: 1
3: 5
4: 110
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776481_1117776496 23 Left 1117776481 14:59189185-59189207 CCGGCGGCTCCGAGAGGGAGAAC 0: 1
1: 0
2: 0
3: 13
4: 94
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776487_1117776496 1 Left 1117776487 14:59189207-59189229 CCCCGAGGCAGGCTTGGTGGACA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776488_1117776496 0 Left 1117776488 14:59189208-59189230 CCCGAGGCAGGCTTGGTGGACAC 0: 1
1: 0
2: 0
3: 17
4: 150
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776476_1117776496 29 Left 1117776476 14:59189179-59189201 CCCGGCCCGGCGGCTCCGAGAGG 0: 1
1: 0
2: 3
3: 20
4: 210
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559
1117776478_1117776496 28 Left 1117776478 14:59189180-59189202 CCGGCCCGGCGGCTCCGAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 60
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117776496 Original CRISPR GGCGGTGGCGACAGGGAAGG AGG Intronic