ID: 1117777693

View in Genome Browser
Species Human (GRCh38)
Location 14:59199386-59199408
Sequence AAGTGGTGATCAGCCCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117777693_1117777699 3 Left 1117777693 14:59199386-59199408 CCGTGCAGGGCTGATCACCACTT 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1117777699 14:59199412-59199434 ACTGGAGTCTGACCACCAGGGGG 0: 1
1: 0
2: 1
3: 19
4: 186
1117777693_1117777696 0 Left 1117777693 14:59199386-59199408 CCGTGCAGGGCTGATCACCACTT 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1117777696 14:59199409-59199431 TAAACTGGAGTCTGACCACCAGG 0: 1
1: 0
2: 3
3: 13
4: 151
1117777693_1117777698 2 Left 1117777693 14:59199386-59199408 CCGTGCAGGGCTGATCACCACTT 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1117777698 14:59199411-59199433 AACTGGAGTCTGACCACCAGGGG 0: 1
1: 0
2: 1
3: 9
4: 180
1117777693_1117777697 1 Left 1117777693 14:59199386-59199408 CCGTGCAGGGCTGATCACCACTT 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1117777697 14:59199410-59199432 AAACTGGAGTCTGACCACCAGGG 0: 1
1: 0
2: 0
3: 60
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117777693 Original CRISPR AAGTGGTGATCAGCCCTGCA CGG (reversed) Intronic
904324256 1:29717619-29717641 AAGTGGTTTTCCGCCCTGGATGG + Intergenic
905119088 1:35667898-35667920 AAGTGTTCAACAGCCATGCATGG - Intergenic
908713590 1:67045790-67045812 AACTGGTCATTAGCCATGCATGG - Intronic
910599156 1:89011965-89011987 CAGAGGGGATCTGCCCTGCATGG - Exonic
910603522 1:89057072-89057094 CAGTGGGGATCTGCCGTGCATGG - Exonic
910608540 1:89114234-89114256 CAGTGGGGATCTACCCTGCATGG - Exonic
910637194 1:89422044-89422066 CAGTGGGGATCTACCCTGCATGG + Intergenic
910680556 1:89859770-89859792 AGCTTGTGATCAGTCCTGCACGG + Intronic
912515377 1:110213473-110213495 AATTGGGGAACAGGCCTGCAGGG + Intronic
915519626 1:156434357-156434379 AAGTGGTGGCCAGGCCTGCATGG - Intergenic
916585564 1:166146936-166146958 ATGTGAGGATCAGACCTGCAAGG - Intronic
918077608 1:181182363-181182385 AAGGGATGAGCAGCCCTGCCTGG + Intergenic
919089951 1:192966261-192966283 AACTGGTGAACAGCTCTGCTTGG + Intergenic
920646399 1:207807184-207807206 AAGTGGTCACCAGCTCTGCCTGG - Intergenic
923788815 1:237093610-237093632 ATGAAGTGATCAGCCCTGGATGG + Intronic
924240362 1:242034143-242034165 AAGTGGTTCACTGCCCTGCAAGG + Intergenic
1063866161 10:10367485-10367507 AGGTGGTGATCTGAACTGCAGGG - Intergenic
1069941236 10:71956901-71956923 ATGTAGGGATCAGCCCTACAGGG - Intergenic
1072887899 10:99296650-99296672 AAGTGGAGCTCAGCCCAGGAGGG - Intergenic
1073642444 10:105266805-105266827 CACTGGTGAGAAGCCCTGCATGG - Intergenic
1074912561 10:117924747-117924769 AACTGGGGCTCAGCCCTGCTGGG - Intergenic
1076707636 10:132310314-132310336 CAGTGCAGATCAGCCCTGGAGGG + Intronic
1077671335 11:4160486-4160508 AAGTGGGGATCAGACATGCCTGG - Intergenic
1080568766 11:33536790-33536812 AAGAGGAGTTGAGCCCTGCATGG - Intergenic
1080607654 11:33877055-33877077 AAGTGGAGTTCTGCCCTACAAGG + Intronic
1086782499 11:90924809-90924831 AAGTGGAGATCAGCTATGAAGGG + Intergenic
1088759564 11:112916369-112916391 AAGCCTAGATCAGCCCTGCATGG - Intergenic
1089652887 11:119926177-119926199 CAGCAGTGAGCAGCCCTGCATGG - Intergenic
1090622633 11:128574906-128574928 AAATGTTGATCATCCCTCCAGGG + Intronic
1090858440 11:130631926-130631948 AAGTAGGGATCAGCCAGGCACGG - Intergenic
1090909497 11:131106089-131106111 AAGTGGAGAAAAGACCTGCAGGG - Intergenic
1092223526 12:6731413-6731435 AACTGGGGATCAGGCATGCAGGG - Exonic
1092777042 12:11952859-11952881 AGGTCGTGATTGGCCCTGCAAGG - Intergenic
1095239084 12:39835712-39835734 TATTGGTGATCCACCCTGCAGGG - Intronic
1096103864 12:48985594-48985616 GAGTGGTGGGCAGCCCTGCATGG - Intergenic
1096308340 12:50498668-50498690 AAGCGGTTTTCTGCCCTGCATGG + Intergenic
1097605061 12:61743663-61743685 AAGTCCTGAACAGCCTTGCAGGG + Intronic
1098414406 12:70216404-70216426 AAGTGGTTATCAGCAGGGCACGG + Intergenic
1101805668 12:108061659-108061681 AAGCTTTGCTCAGCCCTGCAGGG + Intergenic
1102443043 12:112978230-112978252 GCGTGGTGACCAGCCCTTCAGGG - Intergenic
1103421502 12:120788288-120788310 AAGAGTTGATCAGGCCTGCCAGG - Intronic
1104855532 12:131900770-131900792 AAGAGGTGTCCAGCCCTGCTTGG + Intronic
1109954125 13:69543553-69543575 AAATGGTCATCACCTCTGCATGG + Intergenic
1113408445 13:110063079-110063101 AAGTGCGGAGCATCCCTGCATGG + Intergenic
1113656453 13:112070947-112070969 TAGTGGTGCTCAGCCATCCATGG - Intergenic
1117777693 14:59199386-59199408 AAGTGGTGATCAGCCCTGCACGG - Intronic
1118700173 14:68425381-68425403 AAGAGGTGATCAGCCCATGAGGG + Intronic
1119023173 14:71132213-71132235 AAGTGGTGAGCAGCCATACCTGG - Intergenic
1119198862 14:72738314-72738336 AAGTGGTAATAGGGCCTGCAGGG - Intronic
1121772829 14:96565178-96565200 AAGTGCTGATTAGCCCAGTAAGG - Exonic
1121789771 14:96690356-96690378 AAGGGGTGGTGAGCCCTGCTGGG - Intergenic
1122983665 14:105202594-105202616 AATTGGGGACCAGTCCTGCAGGG + Intergenic
1123117476 14:105901214-105901236 AAGGGGTGTTGAGCCCAGCAAGG - Intergenic
1123119561 14:105910479-105910501 AAGTTGTGCTGAGCCCAGCAAGG - Intergenic
1124131844 15:26996883-26996905 AACTCGTGATCAGCCCTCCTCGG + Intronic
1124376888 15:29134103-29134125 TAGTTGTCATCAGCACTGCAAGG - Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1124905047 15:33860372-33860394 AAGTAGTTAACAGCACTGCATGG + Intronic
1126437884 15:48654386-48654408 ACGTTGTGAGCTGCCCTGCAGGG + Intergenic
1126508268 15:49433994-49434016 AGTTGGTGATCAGCACTGAAGGG + Intronic
1128315338 15:66656120-66656142 AGGGTGTGGTCAGCCCTGCAGGG + Intronic
1129161048 15:73748122-73748144 ATGTGGTGATTTGCACTGCACGG - Intronic
1130659470 15:85819054-85819076 ACCTTGTGATCCGCCCTGCATGG + Intergenic
1134462488 16:14441601-14441623 AAGATGTCATCAGCCTTGCAGGG - Intronic
1136644870 16:31604711-31604733 AAGTGGTCTTCTGCCCTGGATGG + Intergenic
1138201293 16:55090659-55090681 CAATAGTGATCAGCCCTCCAGGG - Intergenic
1143274748 17:5701716-5701738 AAGTGCTGGTCAGCCCTGGATGG - Intergenic
1143748587 17:9011909-9011931 AAGTGGTGACCAGCTCTGTGCGG - Intergenic
1143880699 17:10027497-10027519 AAGAGGTGATCAGCCCATGAGGG + Intronic
1148050228 17:44766520-44766542 AAGGGGTGGTCACCCCTGCCAGG + Intronic
1149623497 17:58063417-58063439 AGATGGTGATCAGCCCTGTGTGG - Intergenic
1152380116 17:79938013-79938035 AGGGGATAATCAGCCCTGCACGG - Exonic
1153246731 18:3079380-3079402 AAGTAAAGATCAGCCCTGGATGG - Intronic
1153884217 18:9448674-9448696 AAGGGGCAAACAGCCCTGCAGGG - Intergenic
1156261685 18:35450333-35450355 AGGTGGTGATGAGCCCGTCATGG + Intronic
1157151984 18:45227576-45227598 AAGAGGTGATCAGGCCAGGAGGG - Intronic
1157484944 18:48080132-48080154 CAGATGGGATCAGCCCTGCATGG + Intronic
1164261642 19:23572919-23572941 AAGTGGTTTTCTGCCCTGGATGG + Intronic
1166391185 19:42409772-42409794 AAGTATTGATCAGCCCAGCTGGG - Intronic
1167948887 19:53010708-53010730 AAGGGGGGAAAAGCCCTGCACGG + Intergenic
926141928 2:10372957-10372979 AAGGAGGGATCAGCCCTACAAGG + Intronic
927961704 2:27244302-27244324 AAGTGCTCCTCAGCCCTCCATGG - Intergenic
928067022 2:28175242-28175264 AAGTGCTCTGCAGCCCTGCAGGG - Intronic
929833546 2:45372473-45372495 AAGGGATAATCAGCCCTGCCCGG + Intergenic
930946504 2:57083396-57083418 AAGTTTTGCTCAGCCCTGCCTGG + Intergenic
937041224 2:118822230-118822252 AGGTGGTGGTCAGGCCTGCCAGG + Intergenic
937493408 2:122393368-122393390 AGGTGATTATCACCCCTGCAAGG + Intergenic
937663556 2:124459154-124459176 AAATTGCGGTCAGCCCTGCATGG + Intronic
938186123 2:129233464-129233486 TATTTGTGATCAGCACTGCATGG - Intergenic
938307349 2:130264939-130264961 AATGGGTGTTCAGCCCTGCCTGG - Intergenic
939026594 2:137021037-137021059 AAGTGGTAATGAACCCTCCATGG - Intronic
945743425 2:213691041-213691063 AAGAGGTGATTAGGCCTTCAGGG - Intronic
946589612 2:221230268-221230290 AAGTGGTGACCAGCCTTCAAGGG + Intergenic
947867041 2:233405544-233405566 AAGAGGTGATCAGGCCAGGAGGG + Intronic
1170566681 20:17611711-17611733 CAGAGGGGATCAGCCCAGCATGG + Intergenic
1174121504 20:48269095-48269117 CAGTGGTGATCAGGTCTGTAAGG - Intergenic
1175249849 20:57602744-57602766 AGGTGGTGATCAGCTGGGCAGGG - Intergenic
1176060473 20:63170305-63170327 ATGTGGTGAGTAGTCCTGCAAGG + Intergenic
1176255584 20:64151002-64151024 GAGTGGGGATCAGGCCTTCATGG + Intergenic
1178893053 21:36536030-36536052 AAGTGCTGAACAGCACAGCAGGG - Intronic
1179413944 21:41183192-41183214 AAATGGTGACCAGCTTTGCATGG - Intronic
1181362867 22:22352314-22352336 AAGTTGTCAGCACCCCTGCATGG - Intergenic
1182155849 22:28072397-28072419 AAGTCGTCATCTGGCCTGCAGGG + Intronic
951170126 3:19532342-19532364 AAGTAGAGATAAGCACTGCAGGG - Intronic
952028828 3:29116551-29116573 TAGTGGTGATCAGGCCAGAAAGG + Intergenic
952207559 3:31195430-31195452 AAGTGATGATCTGAACTGCATGG + Intergenic
953607938 3:44424115-44424137 GAGTGGGGAGCTGCCCTGCAGGG - Intergenic
955366376 3:58313769-58313791 GAGTGGTGATCACACCTCCATGG + Intronic
957027262 3:75195950-75195972 AAGTTGTGATCAGACCCCCATGG + Intergenic
961089404 3:124096924-124096946 ATGTGGTGATCAAACGTGCATGG - Intronic
961493499 3:127274078-127274100 AAGTTGTGTGCAGCCCTGCCTGG - Intergenic
962022466 3:131514443-131514465 AAGTGGTTATCCGCCCTGGGCGG - Intergenic
964398841 3:156277402-156277424 AAGTTGTGAACAACCCTGCATGG - Intronic
965545794 3:169915205-169915227 AACTGGTGCTCAACCCTGCTGGG - Intronic
966507976 3:180728042-180728064 ATTTGGTGACCTGCCCTGCATGG + Intronic
970104933 4:12571044-12571066 AAGTGCTGATTAGCTCTTCAAGG - Intergenic
971349365 4:25842866-25842888 CAGTGGTGATCAGGCCAGGAAGG + Intronic
979893505 4:126130890-126130912 AAGTGGTTTTCAGCCCTGGGTGG - Intergenic
980214685 4:129836640-129836662 AAGTGGTCATAAGCCTTGGAAGG + Intergenic
980566571 4:134550576-134550598 AAGTTGTGATCTGCCCTCCTCGG + Intergenic
981865643 4:149415723-149415745 AAGTAGTAATAAGCTCTGCAAGG + Intergenic
982291787 4:153789162-153789184 AAGTAGTGACCAGCCCTCCTCGG - Intergenic
982350370 4:154408836-154408858 AAGTGGTGATGAGGACTGCTGGG - Intronic
982953423 4:161729910-161729932 AAGTAGTGATCAGCATTGCCTGG - Intronic
983444563 4:167833446-167833468 AAGAGGTGATTAGCCCAGGAGGG - Intergenic
985658493 5:1144061-1144083 AGGGGGCGAACAGCCCTGCAGGG + Intergenic
994906314 5:105844200-105844222 AAATGGTGACTAGCTCTGCATGG + Intergenic
996175513 5:120351200-120351222 AAGTGGTTTTCTGCCCTGGATGG - Intergenic
1000348916 5:160337485-160337507 AAGTGGTTACCAGTTCTGCAGGG + Intronic
1004199229 6:13532541-13532563 AAGTGGGAATCAGCCCTGGGAGG - Intergenic
1005266801 6:24120654-24120676 AAGTGATGACCAGCACAGCAGGG + Intergenic
1005412460 6:25564915-25564937 AAGTGGTGTCCAGCCCAGCCTGG + Intronic
1006022843 6:31127515-31127537 GAATGGAGATCAGTCCTGCATGG - Intronic
1011251490 6:85376799-85376821 AAGTGATGGTCAGAACTGCATGG - Intergenic
1013774452 6:113664113-113664135 AAGTGGAGATTCTCCCTGCACGG - Intergenic
1022197498 7:28082968-28082990 CAGTGGTGGTCAGCTCTGGAAGG - Intronic
1023232042 7:38043033-38043055 AAGTGGTGATGACCTCTGAATGG - Intergenic
1030536139 7:110769657-110769679 AAGTGGTGATCAGAATAGCATGG - Intronic
1030677997 7:112404974-112404996 AAGTGTTGGCCAGCCCAGCAGGG + Intergenic
1032609067 7:133391422-133391444 AAGTAATGATCAGCCCAGCTCGG - Intronic
1033348784 7:140545228-140545250 AAGTGCTGCTCAGGCCTGCTGGG - Intronic
1035143086 7:156784047-156784069 AAGTGGTAACCAGCTCTGAATGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1039201408 8:35097458-35097480 AAATTGTGATTAGCACTGCAGGG - Intergenic
1039468129 8:37797799-37797821 AAGTGGAGAGCACGCCTGCAGGG + Intronic
1042717662 8:71792131-71792153 AAGGGGTGATCAGTCCCTCAAGG - Intergenic
1049758379 8:144320804-144320826 GAGTGGTGGCCAGGCCTGCAGGG + Intronic
1051910411 9:22148648-22148670 AACTTGTGCTCAGCCCTGCCTGG - Intergenic
1056764571 9:89436836-89436858 AAGTAGTGGCCAGGCCTGCAGGG - Intronic
1056971575 9:91209190-91209212 AGGTGGGGAGGAGCCCTGCATGG + Intergenic
1057187423 9:93064744-93064766 AAATGATGATCATCCCAGCAAGG - Intronic
1060069384 9:120533096-120533118 AAGGTGTGATCAGCTCTGCCTGG - Intronic
1060874220 9:127068618-127068640 AATTGGTGCTTAGCCCTGGAGGG + Intronic
1186652610 X:11577338-11577360 AACTGGGACTCAGCCCTGCAGGG + Intronic
1186854291 X:13611013-13611035 AAGTGGGGCTCAGTCCTGCTGGG - Intronic
1188125921 X:26368786-26368808 AAGTAGAGAGCAGTCCTGCATGG + Intergenic
1190640990 X:52482620-52482642 ACGTGGTGCTCAGGCCTCCATGG + Intergenic
1190646682 X:52530245-52530267 ACGTGGTGCTCAGGCCTCCATGG - Intergenic
1193115534 X:77772002-77772024 AAGTGTTTATCAGCCAGGCATGG + Intronic
1193313962 X:80042779-80042801 AAGTGGTTTTCAGCCCTGGGTGG - Intergenic
1196696040 X:118613050-118613072 AAGGGGTGATCAACACTGCATGG - Intronic
1199643070 X:149881894-149881916 GGGTGGTGAACAGCCCTGCCAGG + Intronic
1199673412 X:150165311-150165333 ATGTGGTGCACAGCTCTGCATGG - Intergenic
1199877163 X:151942718-151942740 AAGTTGTAATCAGTCCAGCACGG - Intergenic