ID: 1117784173

View in Genome Browser
Species Human (GRCh38)
Location 14:59265466-59265488
Sequence AAGGAGATCCATTATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117784165_1117784173 12 Left 1117784165 14:59265431-59265453 CCAGAACCTGCCCCCCAAAGATC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206
1117784168_1117784173 1 Left 1117784168 14:59265442-59265464 CCCCCAAAGATCTGACAGTAGTA 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206
1117784166_1117784173 6 Left 1117784166 14:59265437-59265459 CCTGCCCCCCAAAGATCTGACAG 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206
1117784170_1117784173 -1 Left 1117784170 14:59265444-59265466 CCCAAAGATCTGACAGTAGTAGA 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206
1117784171_1117784173 -2 Left 1117784171 14:59265445-59265467 CCAAAGATCTGACAGTAGTAGAA 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206
1117784167_1117784173 2 Left 1117784167 14:59265441-59265463 CCCCCCAAAGATCTGACAGTAGT 0: 1
1: 0
2: 2
3: 12
4: 188
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206
1117784169_1117784173 0 Left 1117784169 14:59265443-59265465 CCCCAAAGATCTGACAGTAGTAG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117784173 Original CRISPR AAGGAGATCCATTATGAAGA AGG Intronic
901526382 1:9825399-9825421 AAGGAGAGACATTAACAAGATGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903982970 1:27203286-27203308 AAGGAGATTCCTCATGCAGAAGG - Intergenic
905430995 1:37923516-37923538 AAGGAGATCCCTAAAGGAGAGGG + Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906370771 1:45251692-45251714 AATGTGATCCATGATAAAGATGG - Intronic
906839319 1:49119834-49119856 AAGGAGTTCCTTTATGAATCTGG + Intronic
907891818 1:58644002-58644024 AAGAAGATACATTACTAAGAGGG + Intergenic
908714657 1:67056216-67056238 AGAGAGATCAATTATGTAGAGGG - Intergenic
910819382 1:91329456-91329478 AAAGGGATCCACTAAGAAGAAGG + Intronic
911786949 1:101963060-101963082 AAGGAGCTCCATTCTGCACATGG - Intronic
915849502 1:159306080-159306102 AAGGTGATCTATTATAAGGATGG + Exonic
917255711 1:173114097-173114119 AAGGAGATTGAAGATGAAGATGG - Intergenic
919392429 1:197003892-197003914 AAGGAGATAATTCATGAAGAAGG + Intronic
919463752 1:197908710-197908732 AAGGAAATTCATTTTGAAAAGGG + Intergenic
921948331 1:220904372-220904394 AAGGAAAGCCAGTATGCAGATGG + Intergenic
921977511 1:221218846-221218868 AAGTAGATCCTTTATGAGTAAGG + Intergenic
922228928 1:223668773-223668795 AAGGAGTTCCCTTGTGCAGAAGG - Intergenic
923558571 1:235021325-235021347 AAGGGGGTCCAGTCTGAAGAAGG + Intergenic
1064631349 10:17316168-17316190 AAGGGTACCCATTAAGAAGAGGG - Intergenic
1065095349 10:22275263-22275285 AACCAGATAAATTATGAAGAAGG - Intergenic
1065602813 10:27387164-27387186 AATCAGATCCATTTTCAAGATGG - Intergenic
1066333934 10:34457180-34457202 AAAGGGATCCAATATGAAAAAGG + Intronic
1067484486 10:46635066-46635088 AGGGTGATCAGTTATGAAGAAGG - Intergenic
1067610273 10:47706581-47706603 AGGGTGATCAGTTATGAAGAAGG + Intergenic
1071575244 10:86720824-86720846 AAGAAGATCCAGGAAGAAGACGG + Intronic
1073665750 10:105531758-105531780 AAGGAGATAAATTATAATGATGG + Intergenic
1074134412 10:110614427-110614449 AAAGAGAACCATGGTGAAGACGG - Intergenic
1074191179 10:111139160-111139182 ATGGAGAGCCATTGAGAAGAAGG - Intergenic
1076260230 10:129059266-129059288 AAGGAGAACCCTTAGGCAGATGG - Intergenic
1077244566 11:1529937-1529959 CAGGAGAGCCATCATGAAAATGG - Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1081425687 11:42924217-42924239 AATTAGATTCACTATGAAGAAGG - Intergenic
1086182007 11:83963505-83963527 AGGGAGATACATTAGGAAGGAGG - Intronic
1087054436 11:93919836-93919858 AAAGAGCTCCATTATACAGAGGG - Intergenic
1087470062 11:98561767-98561789 AAGGATATTCATTATGATGCAGG - Intergenic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1092070982 12:5631281-5631303 AAGGAGAACTTTTAGGAAGATGG - Intronic
1092267695 12:6995496-6995518 ACAGAGAACCAATATGAAGAAGG - Intronic
1093177429 12:15928569-15928591 AAGGACAGCCCTTATGAAGTAGG + Intronic
1093450557 12:19308672-19308694 AAGGAGATCCATCATGTTGGAGG - Intronic
1093888861 12:24495309-24495331 AAAGAGAACCAGTATGAAGTAGG + Intergenic
1095984137 12:47988529-47988551 AAGGAGACCCATTGTGAAGAGGG - Intronic
1096344153 12:50830193-50830215 AAAAATATCCTTTATGAAGAGGG - Intergenic
1098871947 12:75826368-75826390 AAGGATATCTATTGTGAATAAGG - Intergenic
1099677765 12:85784917-85784939 AAGGAGTTACATTTTGAATATGG - Intergenic
1100914726 12:99407167-99407189 AAGGCCATTCATTATGATGAAGG + Intronic
1102144101 12:110641613-110641635 AAGGATATCCCTTATGAGGCTGG - Exonic
1106668424 13:31878263-31878285 AAGGACATCCTTTATGAAACGGG - Intergenic
1107623898 13:42262348-42262370 GAGGAAATCCATTATCAAGGTGG + Intergenic
1107687637 13:42920002-42920024 GAAGAGATGCATGATGAAGATGG - Intronic
1108011932 13:46024315-46024337 AAGGATATACATCAGGAAGATGG - Intronic
1108056082 13:46486771-46486793 ATGGAGATGCTTTCTGAAGATGG + Intergenic
1108685546 13:52815781-52815803 AAAGAGACCCATTATGAAAAAGG + Intergenic
1108700512 13:52940288-52940310 AAGGAAAGCCATTTTGAAGGAGG + Intergenic
1109133194 13:58613520-58613542 AAGGATATCCTTCATCAAGAAGG - Intergenic
1109322095 13:60823520-60823542 AAGGACATCCATTGTGATGGAGG + Intergenic
1110355774 13:74565296-74565318 AACAAGATCCAATGTGAAGATGG - Intergenic
1111244096 13:85512090-85512112 AAGAAGACCAAATATGAAGAGGG + Intergenic
1112669718 13:101620999-101621021 AAGCAAATCAATTGTGAAGATGG + Intronic
1113558418 13:111257047-111257069 AAGGAGGTCCAATCTGTAGAGGG - Intronic
1114650057 14:24279032-24279054 ATGTAGATCCTTTATGAGGAAGG + Intergenic
1116173845 14:41439170-41439192 AACAAGATCTTTTATGAAGATGG - Intergenic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1119071983 14:71595755-71595777 AAGGAGAGCAATGATGAGGAGGG - Intronic
1119637041 14:76281975-76281997 AATGAAAAGCATTATGAAGATGG + Intergenic
1120772859 14:88400050-88400072 TATGAGATCTATTCTGAAGAAGG - Intronic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1122784602 14:104157930-104157952 CAGGACATACCTTATGAAGAAGG - Exonic
1123273504 15:17856898-17856920 TTTGAGATCCATTATGGAGAAGG + Intergenic
1128581896 15:68816800-68816822 GAGGGGCTCCATGATGAAGATGG - Intronic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1132815606 16:1824988-1825010 AAGGAGCTCCATTACAAACAAGG + Intronic
1134165823 16:11928545-11928567 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1134318480 16:13141012-13141034 AAGGAGATTCATCTTGTAGATGG + Intronic
1134494899 16:14725195-14725217 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1134500282 16:14764315-14764337 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1134526824 16:14950927-14950949 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1134545582 16:15105421-15105443 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1134580297 16:15364735-15364757 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1134714401 16:16349404-16349426 AAGAAGATCCTTTGTCAAGAAGG + Intergenic
1134722276 16:16392768-16392790 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1134945151 16:18319101-18319123 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1134952415 16:18359254-18359276 AAGAAGATCCTTTGTCAAGAAGG - Intergenic
1135311216 16:21405959-21405981 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1135364168 16:21838410-21838432 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1135447675 16:22532938-22532960 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1135731422 16:24898059-24898081 AGGGAACACCATTATGAAGAGGG - Exonic
1136150370 16:28343854-28343876 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1136166607 16:28457692-28457714 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1136212708 16:28771465-28771487 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1136257430 16:29051384-29051406 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1136307920 16:29384955-29384977 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1136321336 16:29486499-29486521 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1136436016 16:30226469-30226491 AAGAAGATCCTTTGTCAAGAAGG - Intronic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1139855612 16:69977386-69977408 AAGAAGATCCTTTATCAAGAAGG - Intergenic
1140367122 16:74390703-74390725 AAGAAGATCCTTTGTCAAGAAGG + Intronic
1144998593 17:19288026-19288048 CAGGGCATCCTTTATGAAGATGG - Intronic
1145023395 17:19449602-19449624 AGGGAGATGCCTTGTGAAGATGG + Intergenic
1145724634 17:27107182-27107204 AAGATACTCCATTATGAAGAGGG - Intergenic
1145727532 17:27145432-27145454 ACAGACATGCATTATGAAGAGGG + Intergenic
1149282576 17:55124484-55124506 AAGCAGATCCATTGTGAGGCTGG - Intronic
1149655409 17:58307193-58307215 AAGGAGATCCATTCTGGGGTGGG - Intronic
1154113160 18:11587672-11587694 AAGGTGGTCTATTATGTAGATGG + Intergenic
1154117082 18:11620576-11620598 AAGAAGATCCTTTGTCAAGAAGG - Intergenic
1156119762 18:33828367-33828389 ATAGAGAACCCTTATGAAGAAGG - Intergenic
1156355941 18:36339940-36339962 AAGTAGATCCAATAAGAACAGGG - Intronic
1157059791 18:44274837-44274859 AGAGAGCTCCATTATGAAGTTGG - Intergenic
1157090350 18:44629573-44629595 AAGGACTTCTATTATGAGGAAGG + Intergenic
1157365484 18:47060450-47060472 CATGAGATTCATTATGAAAAAGG - Intronic
1157774318 18:50379769-50379791 CAGGGGTTCCAATATGAAGAGGG - Intronic
1158075189 18:53520008-53520030 AAGGCAGTCCATTATCAAGAAGG + Intronic
1161285905 19:3468252-3468274 AAGGGGATCCAATAGGAATATGG + Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1164070368 19:21762753-21762775 AAGCAAATCCATTTTGAATAGGG + Intronic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165990778 19:39811871-39811893 AAGGAGAGCCATGATGGACAGGG + Intergenic
1167917906 19:52757014-52757036 AAGGAGATGCTTTATGGACAAGG + Intergenic
1168598802 19:57701437-57701459 AAGGAGATCCCTTATGAGGGTGG - Exonic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
929039589 2:37730926-37730948 GATGAGAACCATTATGAAGGAGG + Intronic
931418933 2:62107860-62107882 ATGGAGAGCTATTATGAGGAAGG - Intronic
932097391 2:68863732-68863754 AAGGAAAACTATTTTGAAGAAGG - Intergenic
932638785 2:73419878-73419900 AAGGGATTCAATTATGAAGATGG + Intronic
933885685 2:86718287-86718309 AAGGAGATCCTTGAAGAAAAGGG + Intronic
933924493 2:87078419-87078441 AAGGAGATCCTTGAAGAAAAGGG - Intergenic
944322598 2:198365474-198365496 AAGGAGAAAAATTATGAAGTAGG + Intronic
944390697 2:199216324-199216346 AAGGAGAACCCATGTGAAGACGG + Intergenic
945715868 2:213357411-213357433 AAGGACTTCCTTTATGAATATGG + Intronic
947701185 2:232235548-232235570 CAGGAGATAAAATATGAAGAAGG - Intronic
948161958 2:235832290-235832312 AAGGAGAACAATTATTAGGAGGG - Intronic
948204381 2:236155341-236155363 AAAGAGACACATAATGAAGAGGG - Intergenic
1172417979 20:34787546-34787568 AAAGAGATCAATTTTGGAGATGG + Intronic
1175456064 20:59115401-59115423 AAGGAGATTCTTTCTGAGGAGGG - Intergenic
1177240789 21:18454433-18454455 AAGGAGATTCATTATGAAATTGG + Intronic
1178390884 21:32197217-32197239 AAGGACAGACATTGTGAAGAAGG - Intergenic
1180643134 22:17315588-17315610 AAGGGGATCCATTTTAGAGAGGG + Intergenic
1181379421 22:22488696-22488718 AAGGTGCTCCATTCTGAACATGG + Exonic
1182053930 22:27334870-27334892 ATGCAGATTCATGATGAAGATGG + Intergenic
949663896 3:6314402-6314424 AGGAAGATCAATTATGAAAAAGG - Intergenic
952750150 3:36818268-36818290 GAGTACATCCATTATGCAGATGG - Intergenic
952847351 3:37699564-37699586 ACGGAAACCAATTATGAAGAAGG - Intronic
954023505 3:47763120-47763142 AAGGAGATGCATTGAGGAGATGG - Intronic
954997502 3:54895144-54895166 AAGTAGAGCACTTATGAAGACGG + Intronic
955821700 3:62902665-62902687 ATGAAGATCAATAATGAAGAAGG - Intergenic
959491075 3:106989239-106989261 CAGTAGATCCATTTTCAAGATGG - Intergenic
959948007 3:112148194-112148216 AATGAGATCCAAGATGAAGCTGG - Intronic
961584615 3:127911619-127911641 AAGGAAATACATGATGAAGGAGG + Intergenic
962756049 3:138466097-138466119 GAGGACACCCATTATGAAGTGGG + Intronic
963957403 3:151270009-151270031 AAGGAGATAAATGATGAAGAAGG + Intronic
964829786 3:160871351-160871373 AAGGTGATACATTATCAAAAAGG + Intronic
965285650 3:166816677-166816699 AAGGAAATCCATTATAATGTTGG - Intergenic
967319359 3:188180066-188180088 AAGGAGAACCATTTTGTAAATGG + Intronic
967806795 3:193721497-193721519 AAGGAAATCCATTAGGCAGAAGG - Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
972200155 4:36704336-36704358 AAAGAGGTCCATTGTGATGAGGG + Intergenic
973242126 4:47968357-47968379 AAAGAGGTCCATGAAGAAGATGG + Intronic
973290923 4:48469661-48469683 AAGTAGATGCACTGTGAAGAGGG + Intergenic
973956060 4:56064637-56064659 AAGGATATTCATAATGAAAAGGG - Intergenic
975854246 4:78606276-78606298 AAGGTGATCCAGGATGAAGAGGG + Intronic
977852562 4:101847961-101847983 AAAGGGATCCATCAGGAAGATGG - Intronic
981157490 4:141456709-141456731 AAGGAGAGCAATAATGAAGCAGG - Intergenic
984951075 4:185008209-185008231 AAGGACATCCACCAGGAAGATGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
986647515 5:9932177-9932199 AGGGAGATACATTCAGAAGAAGG - Intergenic
986831498 5:11584233-11584255 AAGGAGAGCAACTCTGAAGATGG - Intronic
987826706 5:23039124-23039146 AAGGACATACATTCTGGAGAGGG + Intergenic
990962379 5:61408378-61408400 AAGAAGATAAATTATGAAGGAGG + Intronic
991126163 5:63072073-63072095 AGAAAGATGCATTATGAAGATGG - Intergenic
992970927 5:82056999-82057021 AAGGATATCCATTTTGTAGATGG - Intronic
994706518 5:103213325-103213347 AAGGAGATCCTTTTAGAAAATGG - Intergenic
995160336 5:108972432-108972454 AAGGAGACTAATAATGAAGATGG - Intronic
997312244 5:132896784-132896806 AAGGAAACCCAATATAAAGAAGG - Exonic
997924002 5:138011218-138011240 AATGAGATACTTTATGAACATGG + Intronic
1000086267 5:157889998-157890020 AAGAAAATCCCTTGTGAAGAAGG + Intergenic
1003210972 6:4066296-4066318 AAGGAGGTCCATTCTCGAGATGG + Intronic
1003867664 6:10378265-10378287 AAGGATATCCCTAAAGAAGATGG + Intergenic
1004199873 6:13538127-13538149 AATGAAATCCAATAGGAAGAAGG + Intergenic
1006916581 6:37598153-37598175 AAGGAAATGCAGTATGAAAAAGG - Intergenic
1007800758 6:44390404-44390426 AAGGAGCTTAATTATGATGATGG + Intronic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012742227 6:103032632-103032654 AATGAAATACATTATGAATAAGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014061585 6:117078152-117078174 AAGGATAACCATTAAGAAAAAGG - Intergenic
1014341753 6:120217293-120217315 AAGGAGATCAAAAATGAAGTGGG + Intergenic
1017507899 6:155085262-155085284 AAGAAGATACAATTTGAAGAAGG + Intronic
1022508332 7:30920615-30920637 AATGAGATCCATTTTGCAGATGG + Intronic
1022649673 7:32262864-32262886 AAGGAGAGCCTTTAGGTAGAAGG - Intronic
1023729227 7:43174283-43174305 ATGGAGATCCCTTATGAGGGAGG + Intronic
1024986041 7:55194042-55194064 GAGGAGATACATTCTGAAAATGG - Intronic
1026095362 7:67342262-67342284 AAGGAGATAAATGCTGAAGAAGG + Intergenic
1026408197 7:70090650-70090672 AAGGATAACCTTTAGGAAGAGGG - Intronic
1028624902 7:92866932-92866954 AATGGGATCCAATATGAAGAAGG - Intergenic
1029202644 7:98849310-98849332 AAGGAGATGCAACAAGAAGAGGG + Intronic
1030665242 7:112270212-112270234 AAGGACCTACATTTTGAAGAAGG - Intronic
1031150461 7:118048196-118048218 AAGGTGATCCATTGTGAATAAGG - Intergenic
1032967974 7:137123554-137123576 AAGGAGATCAATTAAAAAGCAGG + Intergenic
1034503949 7:151470632-151470654 AGGGTGATCAGTTATGAAGAAGG - Exonic
1037914839 8:22766702-22766724 AATGGAATCCAATATGAAGATGG + Intronic
1038443849 8:27589448-27589470 AAGGAGCTCCCTTCTGAAGAGGG - Intergenic
1041635843 8:60142937-60142959 AAGGAGATTCTTTCTGATGAAGG + Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1044567012 8:93675539-93675561 AAGAAGAGCAATTATAAAGATGG - Intergenic
1045711530 8:104990277-104990299 AAGGAAATTCATTAGGAAGGTGG - Intronic
1045990267 8:108298256-108298278 AAGGAGATCACTTATGAGGCAGG + Intronic
1048535957 8:135294814-135294836 AAAGAGACCCTTTATGAAGGAGG - Intergenic
1048950553 8:139493262-139493284 AAGGAGATCTATTTTGCAAATGG - Intergenic
1052556707 9:30027799-30027821 AAGGATATCCACTCTGATGAAGG + Intergenic
1055162565 9:73148231-73148253 AATGAGATGCATTCTGGAGAAGG - Intergenic
1055904907 9:81281902-81281924 ATGAAGATGCATCATGAAGAAGG - Intergenic
1057693747 9:97309485-97309507 CAGGATACCCATGATGAAGAAGG + Exonic
1059858129 9:118424594-118424616 AAGGACACCCATACTGAAGAAGG - Intergenic
1060142458 9:121221936-121221958 AAGGAGACCCCTTAAGAAGCAGG - Intronic
1187284662 X:17893423-17893445 AAGGAAATCCATTATCCAGATGG - Intergenic
1191203372 X:57808688-57808710 AAGGACTTGCATTATGAATATGG + Intergenic
1191722097 X:64240057-64240079 AAAAAGAGACATTATGAAGATGG - Intergenic
1196072100 X:111536677-111536699 AAGGACATCCATCAGGCAGAAGG + Intergenic
1199407518 X:147479834-147479856 AAGGAGGTCAAGTATAAAGATGG + Intergenic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic