ID: 1117786551

View in Genome Browser
Species Human (GRCh38)
Location 14:59291860-59291882
Sequence TTTAGTCCTTTCAGTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117786551_1117786556 18 Left 1117786551 14:59291860-59291882 CCACATCCACTGAAAGGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 119
1117786551_1117786554 -9 Left 1117786551 14:59291860-59291882 CCACATCCACTGAAAGGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1117786554 14:59291874-59291896 AGGACTAAAGTCTTTATTCTGGG 0: 1
1: 0
2: 3
3: 16
4: 208
1117786551_1117786555 17 Left 1117786551 14:59291860-59291882 CCACATCCACTGAAAGGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1117786555 14:59291900-59291922 TCACTTCCCATTTAAGATCTAGG 0: 1
1: 0
2: 1
3: 9
4: 152
1117786551_1117786553 -10 Left 1117786551 14:59291860-59291882 CCACATCCACTGAAAGGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1117786553 14:59291873-59291895 AAGGACTAAAGTCTTTATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 205
1117786551_1117786557 19 Left 1117786551 14:59291860-59291882 CCACATCCACTGAAAGGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1117786557 14:59291902-59291924 ACTTCCCATTTAAGATCTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117786551 Original CRISPR TTTAGTCCTTTCAGTGGATG TGG (reversed) Intronic
900677750 1:3899553-3899575 TTTAGCACATTCAGTAGATGGGG + Intronic
901368233 1:8772914-8772936 TTTTGTACTTTTAGTAGATGGGG - Intronic
901730865 1:11278624-11278646 GTTTGTCCTTCCAGTGGCTGTGG + Intronic
902561761 1:17281960-17281982 TTGAGTTCTTTTAGGGGATGAGG - Intronic
904493847 1:30876136-30876158 TTTTCTCCTTTCCGTAGATGAGG + Intronic
905748666 1:40441806-40441828 TTTTGTATTTTCAGTAGATGGGG + Intergenic
907141558 1:52190304-52190326 TTTCATTCTTGCAGTGGATGTGG + Intronic
913164671 1:116173995-116174017 TTTAATCCCTTTGGTGGATGGGG + Intergenic
915866308 1:159503083-159503105 CTTAGTGCTTCCAGTGGAGGGGG - Intergenic
915974456 1:160375777-160375799 TTTTGACCTCTCATTGGATGAGG + Intergenic
916265530 1:162886758-162886780 TTTAGTTCTTGGAGTGGGTGGGG + Intergenic
918465357 1:184816315-184816337 TTTTGTCATTTCAGTTGAAGGGG - Intronic
920382432 1:205543206-205543228 TTTCCCCATTTCAGTGGATGGGG + Intergenic
1063876207 10:10481584-10481606 TTTAGTTCTTTCAGAGTATCAGG - Intergenic
1064626371 10:17266045-17266067 TTTTGTACTTTTAGTGGAGGCGG - Intergenic
1065285083 10:24179758-24179780 TTTTGTATTTTTAGTGGATGAGG + Intronic
1066644280 10:37589665-37589687 TTTTGACCTTTCAGAGCATGTGG + Intergenic
1067372234 10:45695799-45695821 TTTTGTACTTTCAGTAGAGGCGG - Intergenic
1067387544 10:45830341-45830363 TTTTGTACTTTCAGTAGAGGCGG + Intronic
1067446730 10:46354268-46354290 TTTTGTACTTTCAGTAGAGGCGG - Intergenic
1067503935 10:46833502-46833524 TTTTGTACTTTCAGTAGAGGCGG - Intergenic
1067590656 10:47506499-47506521 TTTTGTACTTTCAGTAGAGGCGG + Intronic
1067637774 10:48014601-48014623 TTTTGTACTTTCAGTAGAGGCGG + Intergenic
1067657782 10:48210339-48210361 TTCAGTGCTTTCTGTGAATGGGG + Intronic
1067875718 10:50005747-50005769 TTTTGTACTTTCAGTAGAGGCGG - Intronic
1067972694 10:50991177-50991199 TTTAGTCCATTCAGCAGAAGCGG + Intergenic
1068802546 10:61158422-61158444 TTTAAGGCTTTCAGTGGAGGAGG + Intergenic
1070134372 10:73679022-73679044 TTTTGTACTTTCAGTAGAGGCGG + Intronic
1070243165 10:74703307-74703329 TTTTGTACTTTTAGTAGATGGGG - Intronic
1070514916 10:77195776-77195798 TTTTGTATTTTCAGTGGAGGTGG - Intronic
1072716417 10:97755672-97755694 TTTACCCCTGCCAGTGGATGAGG + Intronic
1075353086 10:121743850-121743872 TTTTGTCGTTGCAGTGGATGAGG - Exonic
1075812768 10:125237662-125237684 TTTTGTATTTTCAGTGGAGGTGG - Intergenic
1075930875 10:126294327-126294349 TGTAGTCCTTGCTGAGGATGAGG + Intronic
1076967560 11:103239-103261 TTCATTCCTTTCAATTGATGAGG + Intergenic
1078030890 11:7749957-7749979 TTTACTCCTTCCAGGGGAGGAGG + Intergenic
1078095028 11:8291601-8291623 TTTCTTCCTTTCAGTGAATGTGG + Intergenic
1080447732 11:32352824-32352846 TTTCTTCCTTTCAAGGGATGGGG - Intergenic
1082032898 11:47619402-47619424 TTTTGTACTTTTAGTGGAGGTGG + Intronic
1082817990 11:57523074-57523096 TTTTGTATTTTCAGTGGAGGTGG + Intergenic
1082892601 11:58156081-58156103 TTTTGTACTTTTAGTAGATGTGG + Intronic
1084501822 11:69539713-69539735 TTTAATTTTTTCAGTGGATGAGG - Intergenic
1085355962 11:75837153-75837175 TTTTGTATTTTTAGTGGATGGGG - Intronic
1085798442 11:79565100-79565122 TTGAGTCCTTTCATAGGTTGGGG - Intergenic
1085910910 11:80824729-80824751 TTATGTCCTTTAAGTGGATTTGG - Intergenic
1085918117 11:80916234-80916256 ATTAATCTTGTCAGTGGATGTGG + Intergenic
1085960262 11:81453708-81453730 TTGAGTCCTTGCTGTGGATCTGG + Intergenic
1087097345 11:94331834-94331856 TTGTGTCCTTTCAGGGGGTGGGG + Intergenic
1088027606 11:105205235-105205257 TTTTGTATTTTCAGTGGAGGCGG + Intergenic
1088810932 11:113391647-113391669 TTTCATCATTTCAGTGAATGGGG - Intronic
1089879331 11:121758394-121758416 TTTAGTCATTTTGGTGGATAAGG + Intergenic
1091477679 12:792484-792506 TTTTGTACTTTTAGTAGATGTGG + Intronic
1091635874 12:2196146-2196168 TTTTGTACTTAAAGTGGATGGGG + Intronic
1096693968 12:53337275-53337297 TTCAGTTCTTTCTGTGGAAGAGG - Intronic
1098245275 12:68510852-68510874 TTTATTCCTTTCAGGGAATTGGG - Intergenic
1098665412 12:73155721-73155743 TTTTTTTCTTTCAGTGGAGGGGG - Intergenic
1099632314 12:85166131-85166153 TTTAGAAGTTTCAGTAGATGAGG - Intronic
1100134800 12:91542652-91542674 TTTAGTCCTTTCAGCACATCAGG + Intergenic
1101208021 12:102508341-102508363 TTTAGTCCTTGCAGGCCATGTGG - Intergenic
1102276710 12:111588012-111588034 TTTTGTATTTTCAGTAGATGTGG - Intronic
1103279063 12:119739690-119739712 TTTAGTACTTTCTATGGATCAGG + Intronic
1106149965 13:27090113-27090135 TTTAGACCTTTCTGTTGACGTGG - Exonic
1107271057 13:38616485-38616507 TTTAACTCTTGCAGTGGATGTGG - Intergenic
1107807497 13:44167868-44167890 TATAATCATTTCAGTTGATGTGG - Intergenic
1109053115 13:57509713-57509735 TTTATTAATTTGAGTGGATGTGG - Intergenic
1109204664 13:59467936-59467958 TTAAGTCCTTTGACTGAATGAGG - Intergenic
1110465303 13:75793444-75793466 TTTTGTCCTTTCAGTAGAGACGG + Intronic
1114949632 14:27732982-27733004 GTTAAAGCTTTCAGTGGATGAGG + Intergenic
1117786551 14:59291860-59291882 TTTAGTCCTTTCAGTGGATGTGG - Intronic
1118545846 14:66887413-66887435 TTTTGTATTTTCAGTAGATGAGG - Intronic
1119015633 14:71050996-71051018 TTTAGTATTTTCAGTGGAGATGG - Intronic
1119734438 14:76972920-76972942 TTTTGTATTTTCAGTAGATGGGG + Intergenic
1119904698 14:78290973-78290995 TTTAGTAGATTCTGTGGATGAGG + Intronic
1121355344 14:93208966-93208988 TTTTGTATTTTTAGTGGATGGGG + Intronic
1121397397 14:93638296-93638318 TTTAGTCCCTGTACTGGATGAGG + Intronic
1125584862 15:40813085-40813107 TTCAGTCCATTCAGGGGCTGAGG + Intronic
1126694746 15:51316501-51316523 TTTGGTTCTTTCAGTAGCTGTGG + Intronic
1127812189 15:62573836-62573858 ATTATTCCTTTCTATGGATGGGG + Intronic
1128479613 15:68025948-68025970 TTTTGTACTTTCAGTAGAGGTGG + Intergenic
1130005010 15:80087340-80087362 TTTAACCATTTTAGTGGATGTGG + Intronic
1131422027 15:92314970-92314992 GTAAGTCCTTTGAGTGGATTAGG - Intergenic
1132421503 15:101673727-101673749 CTTTGTCCATGCAGTGGATGTGG + Intronic
1132725683 16:1337343-1337365 TTTTGTACTTTCAGTGGAGACGG - Intronic
1133799184 16:9071169-9071191 TTTATTCCTTTTGATGGATGAGG + Intergenic
1135661719 16:24302828-24302850 TTTCGTATTTTCAGTAGATGCGG + Intronic
1136404183 16:30034100-30034122 TTTTGTACTTTCAGTAGAGGCGG - Intronic
1136418859 16:30119996-30120018 TTTTGTATTTTCAGTAGATGCGG - Intronic
1137917694 16:52450771-52450793 TATAGAACTGTCAGTGGATGTGG + Intronic
1138527255 16:57616257-57616279 TTTAGTCCTCCCTGTAGATGTGG + Intronic
1138671773 16:58621441-58621463 TTTTGTATTTTCAGTGGATACGG + Intronic
1139180857 16:64746938-64746960 CATATTCCTTTCAGTTGATGGGG - Intergenic
1140428979 16:74885278-74885300 TTTTGTGCTTTTAGTAGATGGGG - Intronic
1141392594 16:83677280-83677302 TTTAGTCCACACAGTGGCTGGGG + Intronic
1141781898 16:86168111-86168133 CTTCGTCCTTCCAGAGGATGGGG - Intergenic
1144191664 17:12852040-12852062 TGGAGTCATTTGAGTGGATGAGG + Intronic
1146485437 17:33238831-33238853 TTTTGTATTTTCAGTGGAGGTGG - Intronic
1148926295 17:51088920-51088942 TTTAGTATTTTTAGTAGATGCGG - Intronic
1149151110 17:53565051-53565073 TTTCTTCATTTCAGTGAATGTGG - Intergenic
1155637646 18:27974756-27974778 TTTGCTCCTTTCATTGTATGAGG + Intronic
1155957354 18:31964976-31964998 TTTTGTATTTTCAGTAGATGGGG - Intergenic
1156410365 18:36822413-36822435 GTGAGTCCTTGCAGTGGATCTGG + Intronic
1157169537 18:45389814-45389836 TTTACTCCTTACAGTGGGTGTGG - Intronic
1158415973 18:57250126-57250148 TTAGGTTCTGTCAGTGGATGGGG + Intergenic
1158975968 18:62712026-62712048 TTTTGTATTTTCAGTGGAGGCGG + Intergenic
1161555665 19:4941259-4941281 TTTTGTATTTTCAGTGGAGGCGG + Intronic
1163482020 19:17562410-17562432 TTCAGTACTTTGAGTGGCTGAGG + Intronic
1164062177 19:21685010-21685032 TTTTGTCCTTTCAGTAGAGATGG + Intergenic
1165483062 19:36077179-36077201 ATTAGTCATTTCCATGGATGGGG - Intronic
1166275592 19:41751353-41751375 TTTGCTCCTTTCAGTAAATGAGG - Intronic
1166366882 19:42282293-42282315 TTCAGCTCTGTCAGTGGATGAGG + Intronic
1166903724 19:46087785-46087807 TTTGGTCCTGGCAGTGGGTGGGG + Intergenic
1168676279 19:58280024-58280046 TTTTGTTCTTGCTGTGGATGGGG + Exonic
927229115 2:20802526-20802548 TTTGGTGCTGTCAGTAGATGAGG - Intronic
928012488 2:27622973-27622995 TAAAGCCCTTTCAGTAGATGAGG + Exonic
928202512 2:29257723-29257745 TTTAGTTCAGTCAGTGGATGTGG - Intronic
932941831 2:76175753-76175775 TCTAGTCATCTCAGTGGATAGGG - Intergenic
933856106 2:86416051-86416073 GCTAATCCTTTCAGGGGATGTGG - Intergenic
934996019 2:98961264-98961286 TTTATTGCTTTCAGTGGAAGTGG - Intergenic
935185477 2:100728209-100728231 TATTGTCATTTCAGTGGCTGTGG - Intergenic
935583689 2:104782338-104782360 TTCAGTCCTTTCATTGACTGGGG - Intergenic
937194908 2:120145051-120145073 TTTAGCTATTTCAGTGGATGTGG - Intronic
938046342 2:128124876-128124898 TTTGGTCTTTTCAGTGGTGGAGG + Intronic
939600234 2:144179745-144179767 TTTAGCCCTTTCAATAAATGTGG - Intronic
940046345 2:149414746-149414768 TTTTGTCCTTTCAGTTCATGGGG - Intronic
940618819 2:156084555-156084577 TTTTGTCCTTGCAGTCGATCTGG + Intergenic
941766834 2:169307248-169307270 TTTAGTCCTTGCACTGTATTTGG - Intronic
945828354 2:214751909-214751931 TATAGGCCCTTCAGTGAATGAGG - Intronic
946776001 2:223141942-223141964 TTTTGTCCTTTCAGTCACTGAGG + Intronic
948043311 2:234922333-234922355 TTTAGGTATTTCAGCGGATGTGG - Intergenic
1169894033 20:10483290-10483312 TTTAGTATTTTTAGTAGATGCGG + Intronic
1170138940 20:13105804-13105826 TTTATTCCATTCAGAGGATTTGG + Intronic
1171346169 20:24468517-24468539 TATATTCCTTTCAGGGGACGTGG - Intergenic
1172320452 20:33992272-33992294 TTTTGTATTTTCAGTGGATACGG - Intergenic
1172871584 20:38138927-38138949 TCTAGACCTTTCAGGGGATGGGG + Intronic
1173677333 20:44847727-44847749 TTTAGGACTATAAGTGGATGGGG - Intergenic
1174532712 20:51226793-51226815 TTGAGTTCTTACAGTGGATCAGG - Intergenic
1176106117 20:63388564-63388586 TTTTGTCTTTTTAGTAGATGGGG - Intergenic
1180177127 21:46096315-46096337 TTTCCCCCTTTCAGTGCATGGGG - Intergenic
950857324 3:16118292-16118314 TTTTGTATTTTCAGTGGAGGCGG + Intergenic
951276886 3:20698526-20698548 TTTTGTACTTTTAGTAGATGCGG - Intergenic
953117520 3:40007848-40007870 TTAAGTCCTTTGATTGGATGAGG + Intronic
953289656 3:41648955-41648977 TTTTGTATTTTCAGTAGATGTGG - Intronic
954182526 3:48892678-48892700 TTTAGGCCTTCAACTGGATGAGG + Intronic
956411365 3:68983342-68983364 CTTAGTATTTTCAGAGGATGAGG - Intronic
957786730 3:84891921-84891943 TTTAGTCCTTTCTGCGTATGTGG + Intergenic
958803206 3:98780128-98780150 ATCAGTCCTTTCAGAGTATGGGG + Intronic
962780676 3:138712735-138712757 TTTTGTCCTTTTAGTGGAGACGG + Intronic
964268360 3:154926858-154926880 TTTTTTCCTTTCAGTGGTAGTGG + Intergenic
965040188 3:163498409-163498431 TTTAGTCATTTAACTGGCTGAGG + Intergenic
965147672 3:164927606-164927628 TTTAGCCCTTTCAGTGTAACAGG - Intergenic
966476787 3:180358028-180358050 TTTTGTATTTTTAGTGGATGTGG - Intergenic
966895036 3:184438262-184438284 TTTTATCCTTTTAGTGGAGGTGG + Intronic
967611428 3:191510335-191510357 TTTAGTCCTTCCAATAAATGTGG - Intergenic
968618971 4:1595148-1595170 TTCTGTCCTTTCAGTGGCTGCGG - Intergenic
969532600 4:7738165-7738187 TATAGTTCTTTCTCTGGATGAGG + Intronic
969940951 4:10730781-10730803 TTTAACCATTTCAGTGTATGAGG + Intergenic
971850840 4:31984863-31984885 TTAAGTCATTTCAGTAGAGGTGG - Intergenic
973192466 4:47401367-47401389 CTCAGTCCTTTAAGGGGATGTGG - Intronic
973633041 4:52837489-52837511 TCTAGTCCTTTCAGAGCTTGTGG + Intergenic
974547098 4:63326268-63326290 TTTTGTCCATTCAGTTAATGTGG - Intergenic
974911800 4:68132189-68132211 TTTGGTACTTTTAGTGGAGGAGG - Intergenic
977467042 4:97395796-97395818 TGGAGTCCTTTCAGTGGATCTGG + Intronic
977573700 4:98656194-98656216 TTTAGCCCTTTCTATGGATTAGG - Intronic
977899984 4:102411222-102411244 TTTAAATCTATCAGTGGATGTGG + Intronic
978893779 4:113860466-113860488 TTTTGTACATTCTGTGGATGTGG + Intergenic
979266795 4:118712827-118712849 CTTCCTCCTTTCAGAGGATGGGG + Exonic
979548309 4:121962235-121962257 TTTTGTATTTTCAGTAGATGCGG - Intergenic
982470716 4:155786776-155786798 TTTTGTATTTTCAGTAGATGTGG + Intronic
982726217 4:158909539-158909561 TTTAATCCTCACAATGGATGAGG + Intronic
983336894 4:166406852-166406874 TTTAGTCCTTTTTGGGGGTGGGG - Intergenic
983470474 4:168148133-168148155 TTGAGTCCTTTGAGTGAATTGGG + Intronic
984507930 4:180642783-180642805 TTTAGTCCTCTCCATGGAAGAGG + Intergenic
988822668 5:34902834-34902856 TTTAGCCCTTTCTGGAGATGGGG + Intergenic
988826810 5:34944557-34944579 TTTCTTCCTTTCTGGGGATGGGG - Intronic
989543023 5:42640159-42640181 TTTATTCTTATCAGTGGTTGTGG + Intronic
989750843 5:44891363-44891385 TTTAGTCATTTCACAGTATGAGG + Intergenic
991489466 5:67167842-67167864 GTTGTTCCTTTCTGTGGATGTGG + Exonic
993679211 5:90854433-90854455 TTTACTACTTTCACGGGATGTGG + Intronic
994256314 5:97600584-97600606 TGCAGTCCTTTGAGTGGAAGTGG + Intergenic
994554015 5:101273751-101273773 TTCATTCCTTTCTGTGGATCTGG - Intergenic
994809671 5:104499083-104499105 ATTGGTGGTTTCAGTGGATGAGG - Intergenic
995627731 5:114097681-114097703 TCTAATACTTTAAGTGGATGGGG - Intergenic
995746171 5:115406468-115406490 TTTTGTACTTTCAGTAGACGGGG + Intergenic
996799251 5:127384777-127384799 TTTAGTGCTTTCAGAGTATCTGG + Intronic
998078624 5:139256587-139256609 TTAAGGTCTCTCAGTGGATGAGG - Intronic
999220042 5:149968259-149968281 TTTAGTCCTTTGAGTATAAGCGG + Intronic
999493564 5:152074707-152074729 TTTACTCCTGTCAGGGCATGCGG + Intergenic
1006613748 6:35311281-35311303 TTTAGTCCTCTTGGTGGCTGTGG + Intronic
1007055696 6:38881916-38881938 TTCCGTCTTTTCAGTTGATGTGG + Intronic
1007105162 6:39278840-39278862 TTTTGTACTTTTAGTGGAGGTGG + Intergenic
1007208163 6:40169632-40169654 TTTAGCCCTCTCATTGGAGGTGG + Intergenic
1010293226 6:74164465-74164487 TTTAGTACTTTCAGTAGAGATGG + Intergenic
1013634345 6:112014922-112014944 TTTAGTACTTTCTGTGGCTTAGG + Intergenic
1014099903 6:117500518-117500540 CTTAGGCCTTACAGTGGAAGTGG + Intronic
1014370360 6:120599330-120599352 TTTATTCTTTTCAGTGTATATGG - Intergenic
1016113368 6:140253762-140253784 TTTTCTCCTTTCAATAGATGGGG - Intergenic
1018393309 6:163357617-163357639 TTTTGTATTTTCAGTGGAGGCGG - Intergenic
1018453208 6:163928220-163928242 TTAGGGCCTTTCAGTGGAGGTGG - Intergenic
1019376189 7:693583-693605 TTCACTCCTTTCTGTGGCTGAGG + Intronic
1020194338 7:6025803-6025825 TTTTGTACTTTTAGTAGATGGGG + Intronic
1022730697 7:33021717-33021739 TTTGCTCCTTTAAGTTGATGAGG - Intronic
1023369985 7:39503508-39503530 TTTTGTATTTTTAGTGGATGGGG - Intergenic
1023594642 7:41815955-41815977 TTTTATTCTTACAGTGGATGAGG - Intergenic
1024758190 7:52561929-52561951 CTTAGACATTTCAGTGGATGAGG + Intergenic
1025057705 7:55778453-55778475 TTTTGTACTTTTAGTGGAGGTGG - Intergenic
1025679953 7:63674118-63674140 TTTTGTATTTTCAGTAGATGGGG + Intergenic
1025763396 7:64416369-64416391 TTTTTTCCTATCTGTGGATGAGG + Intergenic
1025821117 7:64965043-64965065 TGTAGACCACTCAGTGGATGGGG - Intergenic
1027007025 7:74703548-74703570 TTTAGTATTTTTAGTGGATACGG + Intronic
1027163698 7:75820349-75820371 TTTTGTACTTTTAGTGGAGGCGG + Intronic
1029423187 7:100482292-100482314 TTTAGTCCATTCTTTGGAAGGGG - Intergenic
1029815238 7:103087255-103087277 TTTAGCTCTTTCAATGGATGAGG + Intronic
1030332127 7:108282175-108282197 TTTAGTCCTTTCATTAGAAATGG - Intronic
1032323156 7:130902415-130902437 TTTAGTATTTTTAGTAGATGGGG + Intergenic
1032416890 7:131742633-131742655 TTTAGTCCTTCCTGGGGAAGTGG + Intergenic
1036999017 8:13695447-13695469 TATAGTCCTATGGGTGGATGTGG + Intergenic
1037790109 8:21931331-21931353 TTTTGTCTTTTTAGTGGAGGTGG + Intronic
1039098024 8:33908000-33908022 TTGAGTCTTCTAAGTGGATGAGG - Intergenic
1040988006 8:53317471-53317493 TTTAATCCTTACAGTGAATCGGG - Intergenic
1041276000 8:56157873-56157895 TTTATTCCTTTGTGTGGGTGGGG + Intergenic
1042262838 8:66877076-66877098 TTAAGTCTTTTCAGTGGATATGG + Intronic
1048782254 8:138015232-138015254 ATTATTCCTTTTAGTGGTTGAGG - Intergenic
1049501052 8:142966237-142966259 TTTTGTACTTTTAGTAGATGTGG + Intergenic
1050870129 9:10557274-10557296 TTAAATCCTTTCATAGGATGGGG - Intronic
1051936999 9:22455554-22455576 TTTAATCCACTTAGTGGATGTGG + Exonic
1053523122 9:38802187-38802209 TTTTGTACTTTCAGTAGAAGCGG + Intergenic
1053554150 9:39117160-39117182 TTTTGTATTTTCAGTGGATACGG + Intronic
1054195348 9:62026605-62026627 TTTTGTACTTTCAGTAGAGGCGG + Intergenic
1054643059 9:67562084-67562106 TTTTGTACTTTCAGTAGAGGCGG - Intergenic
1056075741 9:83037362-83037384 TTGATTCCATTCAGTGGATGGGG - Intronic
1056408769 9:86303537-86303559 TTTAGCCTTTTCATTTGATGAGG - Intronic
1056556221 9:87690817-87690839 TTTTGTTCTTTCTGTTGATGTGG + Intronic
1058930109 9:109710421-109710443 TTTAATTCTTTCTGTGGATTTGG - Intronic
1059108036 9:111528502-111528524 AGTAGTCCTTTCAGGGAATGTGG + Intronic
1059146289 9:111902946-111902968 TTTTGTACTTTCAGTAGAGGTGG + Intronic
1059184731 9:112257767-112257789 TTTTGTACTTTTAGTGGAGGAGG - Intronic
1185596332 X:1309056-1309078 TTTTGTACTTTCAGTGGAGATGG - Intronic
1187842162 X:23500164-23500186 TTTTGTATTTTTAGTGGATGGGG + Intergenic
1188142601 X:26570313-26570335 TGAAGGCCTTTCTGTGGATGTGG - Intergenic
1188202855 X:27313564-27313586 ATTGGTCCTTTCATTGAATGTGG - Intergenic
1190179461 X:48179670-48179692 TTTTGTCCTTTCAGTAGAAAAGG - Intergenic
1191592169 X:62899042-62899064 TTTAGTACTTTCATTGTTTGAGG + Intergenic
1191842864 X:65525373-65525395 TTTATTTCCTTCTGTGGATGTGG - Intronic
1191925991 X:66310593-66310615 TTTTGTATTTTCAGTGGATATGG + Intergenic
1192327207 X:70143092-70143114 TTTTGTACTTTCAGTAGAGGTGG + Intronic
1193154454 X:78158140-78158162 TTTTGTCCTTGCAGTCGATCTGG - Intergenic
1194133782 X:90113244-90113266 TTTAGACCTTTCTGTTGACGTGG + Intergenic
1194531770 X:95057805-95057827 TATAGTCTTTTCAGCGGATGTGG + Intergenic
1195375768 X:104226499-104226521 TGTAGTACTTACAGTGGATTAGG + Intergenic
1195523731 X:105861160-105861182 TATAGCCATTTTAGTGGATGTGG + Intronic
1196123214 X:112072233-112072255 TTTAGTCCTTTTGTTAGATGAGG + Intronic
1196754205 X:119143606-119143628 TTTAGTCCTTTCTGGAGAAGAGG - Intronic
1196898146 X:120358429-120358451 TTTAGTCCCTGCAGGGGAAGGGG - Intergenic
1197007581 X:121520956-121520978 TTAAGTACTTTAAGTGGTTGAGG + Intergenic
1197687762 X:129460176-129460198 TTTAGTCTTTTAAGTGCATGAGG + Intronic
1198515526 X:137402933-137402955 TTTTGTATTTTTAGTGGATGAGG - Intergenic
1200479563 Y:3683355-3683377 TTTAGACCTTTCTGTTGACGTGG + Intergenic
1202384076 Y:24307278-24307300 TTCATTCCTTTCAATTGATGAGG - Intergenic
1202486707 Y:25362842-25362864 TTCATTCCTTTCAATTGATGAGG + Intergenic