ID: 1117786556

View in Genome Browser
Species Human (GRCh38)
Location 14:59291901-59291923
Sequence CACTTCCCATTTAAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117786552_1117786556 12 Left 1117786552 14:59291866-59291888 CCACTGAAAGGACTAAAGTCTTT 0: 1
1: 0
2: 0
3: 19
4: 200
Right 1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 119
1117786551_1117786556 18 Left 1117786551 14:59291860-59291882 CCACATCCACTGAAAGGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117786556 Original CRISPR CACTTCCCATTTAAGATCTA GGG Intronic
902417724 1:16251306-16251328 CAGATCCCAATTCAGATCTATGG + Exonic
902526395 1:17060715-17060737 CACTACCAATTTAAGATTGATGG - Intergenic
905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG + Intergenic
906088716 1:43158864-43158886 GACTTCCAATTAAAGATCTTAGG + Intergenic
906613830 1:47221729-47221751 CACTGCCCATTTTATAGCTAAGG + Intronic
907240869 1:53080335-53080357 CTCTGCCCATTTGAGATCTTTGG + Intronic
909952043 1:81732090-81732112 CACTTCCCTTTGAAAATATATGG - Intronic
910441036 1:87252292-87252314 CAATTCCAATATAAGATGTAAGG - Intergenic
913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG + Intergenic
915829279 1:159110934-159110956 CACATTCCATTTACCATCTAGGG + Intronic
916690205 1:167182969-167182991 GACTTCCCATTTAGGATCATTGG - Intergenic
917076488 1:171211433-171211455 CACTACCCATTTAGTAGCTATGG + Intergenic
917414748 1:174797327-174797349 CATTTCACATTTAAGAACAAGGG - Intronic
921163821 1:212491628-212491650 CAGTTCCCATTTCGGATATAAGG - Intergenic
923758122 1:236812491-236812513 CACTTCCCATGTATGAGCTGAGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064821649 10:19342291-19342313 CAATAACCATTTAAAATCTAAGG + Intronic
1066229484 10:33418490-33418512 CACTTCCCATTTCATGTCCAAGG + Intergenic
1071263173 10:83939556-83939578 TCCATGCCATTTAAGATCTATGG + Intergenic
1073744795 10:106455498-106455520 TACTTACCATTTAAGTTCTGTGG + Intergenic
1079651454 11:22934973-22934995 CACTTCCCCATTTAGATATATGG - Intergenic
1079720905 11:23812818-23812840 CATTTCCCATTTAGCATCTAGGG + Intergenic
1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG + Intronic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1087827817 11:102786412-102786434 CACTGCCCCTTTAAGACATATGG + Intergenic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG + Intronic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1093334459 12:17885460-17885482 CACTTTCCATTTGAGATCCGTGG - Intergenic
1093390569 12:18614618-18614640 ATCTTCACATTTAAGAGCTAAGG - Intronic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1096059338 12:48683148-48683170 CCTTTCCCATTTAATAGCTATGG - Intergenic
1108558579 13:51620772-51620794 CACTTCCCATTTAGGATTCTGGG - Intronic
1113259334 13:108544304-108544326 CACTTCTCATCTCATATCTAAGG - Intergenic
1116173266 14:41430195-41430217 CACTTTCCAGATAAGATCTCAGG + Intergenic
1116424401 14:44772113-44772135 GACTTTTCATTTAAGATATATGG - Intergenic
1116736023 14:48692715-48692737 AACTTCCCATTTAATATGCATGG - Intergenic
1117089021 14:52231079-52231101 CACTTCCCATTTAAAGTTGATGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1120862657 14:89268782-89268804 CACCTCCCATTTGGAATCTATGG + Intronic
1122620058 14:103051197-103051219 CACTTCTGATTTTAGATTTAAGG + Intronic
1129647062 15:77445905-77445927 AACTTCCCATTTAATATTTTTGG + Intronic
1130226163 15:82059638-82059660 CACTTCCCAGCCAAGATCTTGGG + Intergenic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1138312998 16:56044019-56044041 CTCTTCCCATTTAACATGCATGG - Intergenic
1141359692 16:83384129-83384151 CAATTCCAATCTAATATCTAAGG + Intronic
1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG + Exonic
1143116180 17:4582973-4582995 CCCTTCCCTTCTAAGATCCAAGG - Intergenic
1153794697 18:8610639-8610661 CAGTTTCCATTTCAGATCCACGG - Intronic
1157146474 18:45167866-45167888 CATTTCCCAGTTAAGTTCTGTGG + Intergenic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG + Exonic
926453727 2:13039329-13039351 CCCTTCCCATTTACAATCAATGG - Intergenic
928229228 2:29482046-29482068 CTTTTCCCATTTGAGATCTGTGG - Intronic
928448282 2:31352771-31352793 AACTTCACACTTCAGATCTAGGG - Intronic
929356359 2:41029443-41029465 CACTTCCACATTAAGATGTAAGG - Intergenic
930420177 2:51141397-51141419 CACTTTCCATTTAATCTCCAGGG - Intergenic
930887352 2:56341258-56341280 CACTTCCCCAGTAAGATCTCTGG - Intronic
931092779 2:58904119-58904141 CACTTCCCATTAAAAATCCTTGG - Intergenic
937709776 2:124966590-124966612 CACTTCTCATTTGTGATCTAAGG - Intergenic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
938930995 2:136086905-136086927 CACTACACATTTCAGAACTAAGG + Intergenic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
944276435 2:197843740-197843762 TCCTTCCCCTTTCAGATCTAGGG - Intronic
945642953 2:212453288-212453310 GATTTCCCATTTAAGGTCCATGG + Intronic
945744928 2:213708822-213708844 CACTTGCCATTTAACATTTTGGG - Intronic
945785525 2:214230972-214230994 TGCTTCCAATTTAAGATCTTTGG - Intronic
945877304 2:215291946-215291968 CACTTCACATATAAAATTTATGG + Intergenic
946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG + Intergenic
947601857 2:231456341-231456363 CACTTTCCATAGAAGATCTGGGG - Intronic
1169325139 20:4669682-4669704 CACCAACCATATAAGATCTAAGG - Intergenic
1172822114 20:37746053-37746075 TACTTCCCACTTCAGATCAAGGG - Intronic
1182428624 22:30287750-30287772 AACTTCCCACTTAAGATCAGAGG + Intronic
953146404 3:40279828-40279850 GACTTCCCATTTGAGATTTGTGG + Intergenic
956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG + Intergenic
960819878 3:121718129-121718151 CCTTTGCCATTTTAGATCTAGGG - Intronic
961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG + Intergenic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
972127041 4:35780929-35780951 CACTTCCTATTAAGGATCAAAGG + Intergenic
981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG + Intronic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
985198164 4:187455539-187455561 CATTTCCCATTTCAGTTTTATGG + Intergenic
992860174 5:80901342-80901364 CATTTCCCATTTATGACGTATGG + Intergenic
993806277 5:92414046-92414068 CATTTTACATATAAGATCTAAGG - Intergenic
996794090 5:127325357-127325379 CAATACTCATTAAAGATCTAAGG - Intronic
999046240 5:148472750-148472772 CACTTCCTATTTCAGCTCTCAGG - Intronic
1001289606 5:170447465-170447487 AACTTCCCATTCAAACTCTAGGG - Intronic
1005389276 6:25316970-25316992 AACTTCCCAGTTAAAAACTAAGG - Intronic
1008699399 6:54080496-54080518 CACTTTCTATTTAATATCAATGG + Intronic
1011090169 6:83588929-83588951 AAATTCCCATTTGAGATCTGTGG + Intronic
1011633248 6:89347620-89347642 CACATACCATGTAAGAGCTAAGG + Intronic
1014568822 6:122984371-122984393 CACTTCCCCTTTATGAGTTATGG - Intergenic
1018379974 6:163249875-163249897 CACTTCCCTTTTGAGAACAAAGG - Intronic
1020495609 7:8849185-8849207 CACTTCCCACTGAAAATCAAGGG - Intergenic
1022154900 7:27650371-27650393 CACTTGCCATTTAAAGCCTATGG - Intronic
1022792096 7:33699436-33699458 CATTTTTCATTTAAGATATACGG + Intergenic
1026011188 7:66637725-66637747 CACTTCCCAGTTAATCCCTACGG - Intronic
1026016448 7:66674791-66674813 CACTTCCCAGTTAATCCCTACGG - Intronic
1028664829 7:93329699-93329721 GACTTCCCATTAAAAAGCTATGG + Intronic
1029800184 7:102938735-102938757 CAATTCTCATTGAAGTTCTAAGG + Intronic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG + Intergenic
1041231025 8:55752245-55752267 AACTTCTCATTAAAGATCTGAGG + Intronic
1043394462 8:79823254-79823276 CACTTCCATTTTAAGAAATAAGG + Intergenic
1043548209 8:81338877-81338899 CATTTCCAATTTAAAATGTAAGG - Intergenic
1046653852 8:116872267-116872289 CAATTCCCCTTTAATATCAAGGG + Intronic
1054825013 9:69565161-69565183 CACTTCACATTTTAGATGTTTGG - Intronic
1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG + Intergenic
1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG + Intergenic
1058344608 9:103946370-103946392 CACTGCTCATATAAGAACTAAGG - Intergenic
1058613826 9:106804587-106804609 CACTTCTCATTTAAGAAATGGGG + Intergenic
1060025777 9:120169933-120169955 CATTCCCCATTTAACATATAAGG + Intergenic
1060680797 9:125562291-125562313 CACTTCATATTTAAGAACTGGGG - Intronic
1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG + Intronic
1060918701 9:127405849-127405871 CTCTTCCCATGTAAGACCTTAGG - Intronic
1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG + Intronic
1189236481 X:39490920-39490942 CTATTCCCACTAAAGATCTAGGG + Intergenic
1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG + Intergenic
1193368433 X:80662731-80662753 TACTTTCCTTTTAAGATCAAGGG - Intergenic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1196538226 X:116873046-116873068 CTCTTCTCATTGAAGATCTGAGG + Intergenic
1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG + Intronic