ID: 1117787019

View in Genome Browser
Species Human (GRCh38)
Location 14:59296665-59296687
Sequence CTCACTGCTGTAACCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117787019_1117787021 16 Left 1117787019 14:59296665-59296687 CCACCATTGGTTACAGCAGTGAG 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1117787021 14:59296704-59296726 TGATCCCGTGATCTAGAAACTGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117787019 Original CRISPR CTCACTGCTGTAACCAATGG TGG (reversed) Intronic
901279659 1:8024172-8024194 CTTTCTGCTGAAACTAATGGTGG - Intronic
901500098 1:9647079-9647101 CTCACTTTTGTAACCAAGGCTGG - Intergenic
903551779 1:24162143-24162165 CTCACATCTGGAACCGATGGGGG + Intronic
904390156 1:30179572-30179594 CTCAGTGCTGTATCCCAGGGAGG - Intergenic
905330170 1:37189255-37189277 CTCTCTGCTCTAACCAAGAGAGG + Intergenic
905478411 1:38244962-38244984 CTCAAGGCTGTACCCAAAGGGGG - Intergenic
906733814 1:48105366-48105388 CTGACTGCTCTAACCACAGGAGG - Intergenic
907606876 1:55827096-55827118 CTCACTCCTGTAACCCAGGCTGG + Intergenic
912362441 1:109106068-109106090 CACACTGCAGCCACCAATGGAGG - Exonic
915350593 1:155222597-155222619 CTCACTGCAGTGGCCAATAGGGG + Intergenic
918640819 1:186839161-186839183 CTCACTGCTTCCACCCATGGAGG - Intronic
922364483 1:224851288-224851310 CTCACTTCTGTAACTACTGAAGG - Intergenic
922740786 1:228013297-228013319 CTCAGGGCTGTAACCAGTGAGGG - Intronic
923215215 1:231842748-231842770 TTCATTTATGTAACCAATGGTGG + Intronic
923726646 1:236511443-236511465 CTCAATGATGTAACTAATGGTGG - Intergenic
924414428 1:243844550-243844572 CTCACTGCAGCCTCCAATGGGGG + Intronic
1067990330 10:51204916-51204938 CTCAATGTTGTAACCAAAAGAGG + Intronic
1070463110 10:76689400-76689422 CTGAGTGCTCCAACCAATGGAGG - Intergenic
1072947051 10:99819833-99819855 CTAACTGGTGAACCCAATGGTGG - Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1077212999 11:1382176-1382198 CTTCCTGCTGCACCCAATGGAGG - Intergenic
1077572111 11:3348156-3348178 GTGATTGCTGTAACAAATGGTGG - Intronic
1080142398 11:28938380-28938402 CTGACTGCTTTGACCAATGGAGG - Intergenic
1081403043 11:42664854-42664876 CTCACTCCTGCAACAAAAGGTGG - Intergenic
1082133991 11:48526648-48526670 CTCACTGAGGTTGCCAATGGTGG + Intergenic
1082139393 11:48590330-48590352 CTCACTGTTGTGGCCAGTGGTGG + Intergenic
1082567008 11:54693034-54693056 CTCACTGTTGTTGCCAATGGTGG + Intergenic
1082614644 11:55343783-55343805 CTCACTGTGGTTGCCAATGGTGG + Exonic
1082621798 11:55432029-55432051 CTCACTGTTGTTGTCAATGGTGG + Intergenic
1082637362 11:55612982-55613004 CTCAGTGCTGGAACAAATGCTGG - Intergenic
1084402906 11:68955679-68955701 CCCACTGCAGTAAGCAATTGGGG - Intergenic
1089054355 11:115573126-115573148 CTGAATGCTGTATCCAAAGGAGG - Intergenic
1089884009 11:121801931-121801953 CTCACTGCATAAACAAATGGGGG - Intergenic
1092090506 12:5799923-5799945 CTTACTGCTGTATCCAGTGTGGG - Intronic
1097709848 12:62906019-62906041 CTTACTGCTGTAACAAATTGTGG + Intronic
1100283335 12:93139584-93139606 TTCAATGGTTTAACCAATGGAGG - Intergenic
1102843608 12:116153370-116153392 CTGCCTGCTCTAACTAATGGAGG - Intronic
1104271862 12:127289527-127289549 CTCACTGCTGTAAGCACTACAGG - Intergenic
1104835501 12:131787330-131787352 CTCACTGGCGGCACCAATGGAGG - Intronic
1104888565 12:132127060-132127082 CTCTCTGCTGTCACCACAGGGGG + Intronic
1109387085 13:61644713-61644735 CTCACTGCTATAGCCAATGCTGG - Intergenic
1113814212 13:113160350-113160372 CTCACTGCTGTAGGGAAAGGTGG - Intronic
1114449145 14:22813381-22813403 CTCAGTGCTGTCAACCATGGTGG + Exonic
1117787019 14:59296665-59296687 CTCACTGCTGTAACCAATGGTGG - Intronic
1121428497 14:93870769-93870791 CTCAGTGCAGTAACCAACTGTGG + Intergenic
1121810251 14:96880463-96880485 CTAACTGCTGTACCCAGAGGTGG + Intronic
1122761676 14:104033377-104033399 GTCCCTGCTGTAACCCAGGGTGG + Intronic
1124485177 15:30108028-30108050 CTCACTCCTGTCACCCAGGGTGG + Intergenic
1124518401 15:30389244-30389266 CTCACTCCTGTCACCCAGGGTGG - Intronic
1124540252 15:30577004-30577026 CTCACTCCTGTCACCCAGGGTGG + Intergenic
1124758401 15:32430574-32430596 CTCACTCCTGTCACCCAGGGTGG - Intergenic
1125415742 15:39450540-39450562 CTCTCTGCTCTTACCCATGGGGG + Intergenic
1127390020 15:58497809-58497831 CTCACTGCTGAGCCCAAGGGAGG - Intronic
1129353157 15:74969334-74969356 CTCACTGCTGTCACCCAGGCAGG + Intronic
1132543322 16:521548-521570 CTCGCTGCAGTAACCCCTGGGGG + Exonic
1135036569 16:19083239-19083261 CACACTGCTTCCACCAATGGTGG + Intergenic
1135630544 16:24032897-24032919 CTCAATGCTGAAAACAGTGGTGG - Intronic
1135767364 16:25189248-25189270 CTCACTCCTGTCACCCATGTTGG + Intergenic
1139027911 16:62841815-62841837 AGAACTGCTGTAACCAATAGAGG - Intergenic
1142317600 16:89358038-89358060 CTTACTGCTTTGAACAATGGAGG + Intronic
1144074110 17:11701473-11701495 CTCCCTTCTGTAGCCAATGAGGG - Intronic
1145749712 17:27346585-27346607 CTCACTTCTGAAACCTTTGGAGG - Intergenic
1149188459 17:54030126-54030148 CTGAGTGCTGTAGCCTATGGTGG - Intergenic
1150358288 17:64506617-64506639 CTCACGTCTGTAACCAAAAGAGG + Exonic
1152295342 17:79463990-79464012 GTCACGGCTGCTACCAATGGTGG - Intronic
1152807786 17:82365176-82365198 CCCAATGCTGAAACTAATGGAGG - Intergenic
1153502093 18:5760142-5760164 CTCAATGCTGTACACATTGGTGG - Intergenic
1158017638 18:52803350-52803372 CTCACTGCAGTAACAATGGGAGG + Intronic
1162499896 19:11046916-11046938 CTCACCTCTGTCACCCATGGTGG - Intronic
925616340 2:5747703-5747725 CTCACTGCTGAGTCCAAGGGTGG + Intergenic
928130520 2:28645825-28645847 TTCACTGCTGGAACCAGTGGCGG - Intergenic
929850886 2:45589384-45589406 CTCCCTGAGGTAACCAAGGGAGG + Intronic
931436407 2:62251071-62251093 CTCACTGTTGTCACCCAGGGTGG + Intergenic
940392438 2:153147899-153147921 CTCAATGCTGTAAGTACTGGAGG + Intergenic
941689096 2:168479976-168479998 ATCACAGCTCTAACAAATGGTGG - Intronic
946754833 2:222933496-222933518 CTCACTGCAGTGTCCCATGGAGG + Intronic
946881924 2:224185154-224185176 CTGAATGCTGAAACCAAGGGAGG + Intergenic
947401700 2:229736888-229736910 CCCACTGCTGCCACCACTGGAGG + Intergenic
1173632466 20:44526936-44526958 CTCTCAGCTGTCACCATTGGAGG - Intergenic
1173887831 20:46477410-46477432 CTCACTGCTGCCTCAAATGGTGG + Intergenic
1176039498 20:63056743-63056765 ATCACTACTGCAACCACTGGGGG + Intergenic
1180981455 22:19879930-19879952 CTCACTGCTGTGACACATGGTGG + Intronic
1181623224 22:24104974-24104996 CTTACTGCTGGAGCAAATGGAGG + Intronic
1184457255 22:44618284-44618306 CTCACTGCTGCACCCAGTGCTGG - Intergenic
954591867 3:51789820-51789842 TTGACTGCTGTCACCAATTGTGG - Intergenic
957851751 3:85817084-85817106 CTTACTGCTGTTTCCAAGGGTGG - Intronic
959483244 3:106898823-106898845 ATCACTGCTGTTTCCAGTGGGGG - Intergenic
961043429 3:123693281-123693303 ATCACTGCTGTAAACAAAGTGGG - Intronic
964347749 3:155771309-155771331 CTCACTTCTGTCACCAAGGCTGG + Intronic
965045860 3:163576242-163576264 CTCATTGCTTACACCAATGGAGG - Intergenic
968516668 4:1018422-1018444 CTCACTGCTGTCAGGTATGGAGG - Intronic
968521839 4:1037695-1037717 GTCACTGCTGAAACCAGGGGCGG - Intergenic
969382673 4:6815266-6815288 CTCAGTGCTGTGACCATTAGAGG + Intronic
971658726 4:29384544-29384566 CTCACTGCTATCAACAATGGTGG + Intergenic
972186084 4:36529792-36529814 CTGACTGCTGTCACCACTGGTGG - Intergenic
973858029 4:55033011-55033033 CTCACTGTTGTATCCAAGTGTGG + Intergenic
974221471 4:58978186-58978208 CTCACAGCTGTAACCAAATGTGG + Intergenic
976748220 4:88427342-88427364 CTCCCTGCTGTAGTCAGTGGAGG + Intronic
981250921 4:142599290-142599312 CCCACTGCTGCCACCAATTGGGG + Intronic
990755643 5:59066474-59066496 CATTCTGCTGTAACAAATGGTGG - Intronic
992612823 5:78522177-78522199 CTCACAGCTGTAATCTAGGGAGG + Intronic
992875455 5:81050087-81050109 CTCACTGCAGTCACCACTTGTGG + Intronic
993022246 5:82605635-82605657 CTGACTGCTGCCACCAGTGGTGG + Intergenic
994750917 5:103735945-103735967 TTTATTGCTATAACCAATGGTGG + Intergenic
997633944 5:135390689-135390711 GTCAATGCTGTGACCACTGGAGG + Intronic
999532906 5:152481877-152481899 CTCACTGCTATAGCAAATGAAGG - Intergenic
1004053292 6:12109291-12109313 TTCACTGCTTTAAGAAATGGCGG - Intronic
1005034186 6:21540473-21540495 TTCATTTCTGTAACCCATGGTGG - Intergenic
1007252202 6:40503417-40503439 CTCACTGGTGCAGCCGATGGAGG + Intronic
1011458207 6:87575412-87575434 GTCATTGCTATAAGCAATGGAGG + Intronic
1011745488 6:90403807-90403829 CTCACAGCTGGAAACAAGGGAGG + Intergenic
1017986216 6:159445276-159445298 GTGACTGCTCTGACCAATGGAGG + Intergenic
1018705283 6:166459926-166459948 TTCACTGCTGTCCCCAGTGGGGG - Intronic
1021651390 7:22836965-22836987 CTAACTACTGTTACCAGTGGAGG - Intergenic
1022806339 7:33826125-33826147 CTCACTCCTGTTACTAATGGGGG - Intergenic
1023677880 7:42649855-42649877 CTCACTGCTGTTTCCTCTGGTGG + Intergenic
1026892615 7:73991161-73991183 CTCACTGCTGTGCCCATGGGAGG + Intergenic
1026915991 7:74120764-74120786 CTGACTGCAGTACCCCATGGGGG - Intronic
1027410517 7:77912760-77912782 CTCACTGCTGTAGTCCTTGGTGG + Intronic
1027948327 7:84780109-84780131 CACACTGCTGTGACTAATGGCGG - Intergenic
1029033473 7:97493128-97493150 CTCACTGCTGTAAAATATGTTGG - Intergenic
1030873522 7:114786044-114786066 AGCACTGGTGTACCCAATGGAGG - Intergenic
1032434956 7:131893091-131893113 CTCACTCCTGTAGCCCAGGGTGG + Intergenic
1032615478 7:133465013-133465035 CTCACTGCTGTTACCCAGGCTGG + Intronic
1032710018 7:134453093-134453115 CTCCCTGCTGTCATCAGTGGTGG - Intronic
1036101613 8:5793171-5793193 CTTACTGCTCTAACCTTTGGTGG - Intergenic
1044533293 8:93332359-93332381 CTCTCTGCTGTAAGCAATGAGGG + Intergenic
1044626347 8:94237760-94237782 CTGAATGCTGTTACCAAAGGAGG - Intergenic
1045036210 8:98178403-98178425 CTCACTGCTGAAGCCCATTGTGG + Intergenic
1045106317 8:98896276-98896298 ATCACTGCTTTAAGCAATGGAGG - Intronic
1048376554 8:133827643-133827665 CTCTTTGCTGAACCCAATGGAGG - Intergenic
1049309341 8:141925040-141925062 GTCACTGATGTAACCCATGTGGG - Intergenic
1053479465 9:38405247-38405269 CTCACTGCTGGATGCAATCGAGG + Intergenic
1053598235 9:39585155-39585177 CTCTCTGCTGTCACCAGGGGAGG + Intergenic
1053856264 9:42342164-42342186 CTCTCTGCTGTCACCAGGGGAGG + Intergenic
1061308007 9:129743533-129743555 CTCACCGCTGTCACCTATGCAGG - Intronic
1185934655 X:4241868-4241890 CTCTCTGCTTTATCCACTGGAGG + Intergenic
1187997429 X:24943035-24943057 CTCTCCACTGTAACCAGTGGTGG + Intronic
1192206180 X:69097980-69098002 CTTACTGCTGTGGCCAATGCAGG + Intergenic
1192430702 X:71109645-71109667 CTCACTGGTGTCAGGAATGGTGG + Intronic
1197439550 X:126472596-126472618 ATCACTGCTGTCTCCCATGGGGG + Intergenic
1201512166 Y:14776949-14776971 CTCAGTGCTGGAATCAAAGGAGG - Intronic