ID: 1117787781

View in Genome Browser
Species Human (GRCh38)
Location 14:59305009-59305031
Sequence CTTTCAGAATGTCATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1697
Summary {0: 1, 1: 2, 2: 61, 3: 486, 4: 1147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117787781_1117787788 26 Left 1117787781 14:59305009-59305031 CCTACTTTATGACATTCTGAAAG 0: 1
1: 2
2: 61
3: 486
4: 1147
Right 1117787788 14:59305058-59305080 AGCAAGATGTGAGGCAGCAAAGG 0: 1
1: 0
2: 1
3: 20
4: 321
1117787781_1117787787 17 Left 1117787781 14:59305009-59305031 CCTACTTTATGACATTCTGAAAG 0: 1
1: 2
2: 61
3: 486
4: 1147
Right 1117787787 14:59305049-59305071 AAATGTGGTAGCAAGATGTGAGG 0: 1
1: 0
2: 1
3: 26
4: 290
1117787781_1117787786 2 Left 1117787781 14:59305009-59305031 CCTACTTTATGACATTCTGAAAG 0: 1
1: 2
2: 61
3: 486
4: 1147
Right 1117787786 14:59305034-59305056 GGGTCTGGTAGCTACAAATGTGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117787781 Original CRISPR CTTTCAGAATGTCATAAAGT AGG (reversed) Intronic
900811979 1:4811142-4811164 CTTTTGGAATGTCACATAGTTGG - Intergenic
900958073 1:5900480-5900502 CTTCCAGAATGTCATACAGCTGG - Intronic
901373972 1:8824324-8824346 TTTCCAGAATGTCAGATAGTTGG - Intergenic
901392113 1:8953098-8953120 CTTCCAAAATGTCATATGGTTGG + Intronic
901406662 1:9052325-9052347 TTCCCAGAATGTCATATAGTTGG - Intronic
901573318 1:10179674-10179696 GCTACAGAGTGTCATAAAGTAGG - Intronic
902944995 1:19829128-19829150 TTTCCAAAATGTAATAAAGTTGG + Intergenic
902972657 1:20065487-20065509 ATTCCAGAATGTCATATAGCTGG + Intronic
902981415 1:20126230-20126252 GTTTCAGAATGACACAAAGCTGG + Intergenic
903819509 1:26091211-26091233 TTTCCAGAATGTCATATAGTTGG - Intergenic
906452779 1:45966088-45966110 TTTCCAGAATGTCATATAGTTGG + Intronic
906701659 1:47864021-47864043 TTTCCAGAATGTCATATAGTTGG - Intronic
906806401 1:48782987-48783009 TTTCCAGAATGTCATATAGTTGG + Intronic
907025849 1:51117577-51117599 TTTCCAGAATGTCATATAGTTGG + Intronic
907288347 1:53396431-53396453 CTTTCAGGATGTCATAGACATGG + Intergenic
907315602 1:53569079-53569101 TTTTCAGAGTGTCATATGGTTGG - Intronic
907626804 1:56038570-56038592 CCTTCAGGATGTCCAAAAGTCGG - Intergenic
907875653 1:58484828-58484850 TTTCCAGAATATCATATAGTTGG - Intronic
907882144 1:58560566-58560588 TTTCCAGAATGTTATATAGTTGG - Intergenic
908585921 1:65568142-65568164 ATGTCATAATGTCATATAGTTGG + Intronic
908644860 1:66266309-66266331 CTTTCAGAATATGATAAACATGG + Intronic
908804017 1:67910914-67910936 TTTTCATAATGTCATCTAGTTGG + Intergenic
909102574 1:71367772-71367794 TTTCCATAATGTCATATAGTTGG + Intergenic
909164834 1:72206788-72206810 ATTTCAGAAAGTCCTAAAGAAGG + Intronic
909471053 1:76028607-76028629 TTTCCAGAATGTCATACAGTTGG - Intergenic
909504217 1:76369693-76369715 CTCTCAGAATCTCAGAAACTAGG + Intronic
909518591 1:76540878-76540900 CTTTAAGGATTTCATAATGTTGG + Intronic
909611731 1:77557958-77557980 TTTCCAGAATGTCATATAATTGG + Intronic
909645644 1:77914006-77914028 TTTCCAGAATGTCATACAGTTGG - Intronic
909728222 1:78861867-78861889 TTTCCAGAATGTCATATAGTTGG + Intergenic
910084821 1:83387736-83387758 TTTTCAGAATGTCATATCATTGG - Intergenic
910189191 1:84577420-84577442 TTTCCAGAATGTCACATAGTTGG + Intergenic
910732177 1:90409956-90409978 TTTACAGAATGTCATGTAGTTGG + Intergenic
910767985 1:90801580-90801602 TTTTCAGAATGTCATATAGCTGG + Intergenic
910890037 1:92008724-92008746 TGTCCAGAATGTCATATAGTTGG + Intronic
910987272 1:93017570-93017592 TTTCCAGAATGTCATATAATTGG - Intergenic
911318705 1:96386297-96386319 TTTCCAGAATGTCATGTAGTAGG - Intergenic
911342981 1:96661875-96661897 TTTCCAGAATGTCATATAGTTGG + Intergenic
911351128 1:96756707-96756729 TTTCCAGAATGTCATATAGTTGG - Intronic
911390598 1:97236487-97236509 TTTCCAGAATGTCATATAGTTGG - Intronic
911402785 1:97397586-97397608 TTTCCAGAATGTCATATAATTGG + Intronic
911471309 1:98322222-98322244 TTTCCAGAATGTCACATAGTTGG - Intergenic
911573903 1:99551267-99551289 TTTTCTGAATGACATAAAGTAGG - Intergenic
911579180 1:99615714-99615736 TTCTCAGAAAGTCATATAGTTGG - Intergenic
911723321 1:101215001-101215023 TTGCCAGAATGTCATATAGTAGG - Intergenic
911813716 1:102315543-102315565 TTTTCAGAATGTCATTTAGTTGG - Intergenic
911946992 1:104123760-104123782 TTTCCAGAATGTCATATAGTTGG + Intergenic
912010890 1:104960911-104960933 TTTTCAGAATGTAATACAGTTGG - Intergenic
912153831 1:106891336-106891358 TTTTCAGAATGTCTTATAATTGG + Intergenic
912257603 1:108076856-108076878 TTTCCAGAATGTCATACAGTTGG + Intergenic
912306486 1:108572831-108572853 TTTCCAGAATGTCCTATAGTTGG + Intronic
912367557 1:109147367-109147389 TTTCTAGAATGTCATATAGTTGG - Intronic
912407284 1:109451162-109451184 TATTCAGAATGCCATAAAGTGGG - Intergenic
912626640 1:111210451-111210473 TTTCCAGAATGTCATATAGTTGG + Intronic
912660690 1:111526911-111526933 TTTTCAGAATGTCATATATTTGG + Intronic
912754429 1:112312707-112312729 CTTTAATACTGTCAAAAAGTGGG + Intergenic
912854514 1:113155132-113155154 TTTACAGAATGTCATATAGTTGG + Intergenic
912997422 1:114544890-114544912 TTTCCAGAATGTCATATAGTTGG + Intergenic
913235450 1:116777183-116777205 TTTCCAGAGTGTCATATAGTTGG - Intergenic
913499496 1:119458536-119458558 TTTCCAGAATGTCATATATTTGG - Intergenic
913503521 1:119494439-119494461 TTTCCAGAATGTCATATAGTTGG - Intergenic
913507437 1:119530588-119530610 TTTCTAGAATGTCATATAGTTGG - Intergenic
913571165 1:120121306-120121328 TTTCCAGAATGTCACATAGTTGG + Intergenic
914291974 1:146282283-146282305 TTTCCAGAATGTCACATAGTTGG + Intergenic
914512873 1:148350127-148350149 TTCTCAGAATGTCCTACAGTTGG - Intergenic
914553018 1:148733066-148733088 TTTCCAGAATGTCACATAGTTGG + Intergenic
915429425 1:155854553-155854575 CTTCCACAAGGTCATAAAGCTGG - Intronic
915769477 1:158404842-158404864 TTTCCAGAATGTCATGTAGTTGG - Intergenic
916149254 1:161770142-161770164 TTTGCAGAATGTCATATAGTTGG + Intronic
916190997 1:162178062-162178084 TTTCCAGAATGTCATATAGTTGG + Intronic
916277423 1:163009754-163009776 TTTCCAAAATGTCATATAGTTGG - Intergenic
916284622 1:163093271-163093293 GTATCAGAATGACATAAAGTAGG - Intergenic
916345230 1:163782027-163782049 TTTTCAGAATATCATAATGTTGG - Intergenic
916374704 1:164140068-164140090 TTTCCAGGATGTCATACAGTTGG - Intergenic
916657992 1:166894525-166894547 TTTCCAGAATGTCATATAGTTGG + Intergenic
916775492 1:167959101-167959123 TTTCCAGAATGTCATATAATTGG + Intronic
917598093 1:176550066-176550088 TTTTCAGAATGTCATAGAAATGG + Intronic
917836974 1:178948955-178948977 TTTCCAGAATGTCATATCGTTGG - Intergenic
917845009 1:179013484-179013506 TTTTCAGAATGTCATAAAAATGG - Intergenic
918273886 1:182931994-182932016 TTTCCAGAATGTCATATAGTTGG + Intronic
918288465 1:183081957-183081979 TTCCCAGAATGTCATATAGTTGG + Intronic
918463405 1:184798079-184798101 CTTTCAGAGTTTCATCAAGCAGG + Exonic
918584265 1:186167705-186167727 TTTCCAGAATGTCATATAGTTGG + Intronic
918707911 1:187691449-187691471 TTTCCAGAATGTCATATACTTGG - Intergenic
918767453 1:188505306-188505328 TTTTAAGAATGTCATATAGTTGG + Intergenic
918776895 1:188643660-188643682 GCTTTAGAATGTCATAGAGTTGG + Intergenic
919143681 1:193606308-193606330 TTTTCAGAATGTCATATAAATGG - Intergenic
919272726 1:195370806-195370828 TTTCCAGAATGTCATATAGTTGG - Intergenic
919406233 1:197187740-197187762 TTTCCAGAATGTCATATGGTTGG - Intronic
919423295 1:197398809-197398831 CTTCCAGAATGTCATATAAATGG - Intronic
919510962 1:198463414-198463436 TCTACAGAATGTCATATAGTAGG + Intergenic
919556514 1:199061740-199061762 TTTTCAGAATGTCATATAGCTGG - Intergenic
919652668 1:200165569-200165591 TTTCCAGAATGTCACACAGTTGG + Intronic
920162188 1:204007491-204007513 TTTCCAGAATGTCATATTGTTGG - Intergenic
920351307 1:205339728-205339750 CCTTCAGCATGTCATAGTGTTGG + Exonic
920507714 1:206528332-206528354 TTTCCAGAATATCATATAGTTGG - Intronic
920519969 1:206616460-206616482 TTTCCAGAATGTTATATAGTTGG - Intergenic
920617507 1:207508067-207508089 TTTCCAGAATGGCATATAGTTGG - Intronic
920889347 1:209968606-209968628 TTTCCAGAATGTCATATAGTTGG + Intronic
920997869 1:211012558-211012580 TTTTCAGAATGTCATAACATAGG - Intronic
921243542 1:213212297-213212319 TTTCCAGAATGTCATATAGTTGG + Intronic
921289542 1:213644588-213644610 TTTCCAGAATCTCATATAGTTGG + Intergenic
921422554 1:214965080-214965102 TTTCCAGAATGTCATATAGTTGG + Intergenic
921435188 1:215111054-215111076 TTTTCAGAATGTCATATAGTTGG + Intronic
921522755 1:216176765-216176787 TTTCCAGAAAGTCATATAGTTGG + Intronic
921578578 1:216867978-216868000 TTTTGTGAATGTCATAAAATGGG + Intronic
921658072 1:217764309-217764331 CTTCCAGAATGTCAGATTGTTGG + Intronic
921790826 1:219288389-219288411 TTTCCAGAATGTCATATATTTGG - Intergenic
922181361 1:223235582-223235604 TTTCCAAAATGTCATATAGTTGG + Intronic
922231087 1:223687095-223687117 TTTCCAGAATGTCATATATTTGG + Intergenic
922254531 1:223882126-223882148 TTTCCAGAATGTCATATAGTTGG - Intergenic
922637432 1:227188621-227188643 TTTCCAGAATATCATATAGTTGG - Intronic
922893480 1:229080416-229080438 TTTCCAGAATGTCGTACAGTTGG + Intergenic
922997798 1:229980385-229980407 TTTCCAGAATGTCATATAGTTGG - Intergenic
923417111 1:233773654-233773676 TTTCCAGAATGTCATATATTTGG + Intergenic
923627465 1:235625654-235625676 TTTCCAGGATGTCATATAGTGGG + Intronic
923717715 1:236439069-236439091 TTTGCAGAATGTCACATAGTTGG + Intronic
923747134 1:236711745-236711767 CTTTCAGCATCCCAAAAAGTAGG - Intronic
923931628 1:238705356-238705378 TTTTCAGAATGTCATATAAAGGG + Intergenic
923961949 1:239095580-239095602 TTTCCAGAATGTCATATAGGTGG - Intergenic
923978680 1:239295219-239295241 TTTACAGAAAGACATAAAGTAGG - Intergenic
924126392 1:240857597-240857619 TTTCCACAATGTCATAGAGTTGG + Intronic
924132240 1:240923113-240923135 TTTACAGAATGTCATAGGGTTGG - Intronic
924167548 1:241300486-241300508 TTTCCAGAATGTCAAATAGTTGG + Intronic
924184436 1:241472865-241472887 TTTCCAGAATGACATATAGTTGG + Intergenic
924214474 1:241806544-241806566 TTTCCAGAATGCCATATAGTTGG - Intergenic
924364504 1:243276867-243276889 CTTGCAGAATGTCATATACTTGG + Intronic
924484921 1:244472844-244472866 TTTCCAGAATGTCATTTAGTGGG + Intronic
924878374 1:248130195-248130217 CATTCAGAATGGCACCAAGTTGG + Intergenic
1062864405 10:839034-839056 TTTGCAGAATGTCCTAGAGTTGG - Intronic
1062866471 10:859799-859821 TTTCCAGAATGTCATAGGGTTGG - Intronic
1062984103 10:1751100-1751122 TTTCCAGAATGTCATAGAGTTGG - Intergenic
1062999478 10:1901543-1901565 TTTTCAGAATGTCACATAGATGG + Intergenic
1063011939 10:2030925-2030947 TTTCCAGAATGTCTTAGAGTTGG + Intergenic
1063021507 10:2133686-2133708 TTTCCAGAATGTCATATATTTGG - Intergenic
1063063497 10:2584418-2584440 TTTCCAGAATGTCATATTGTTGG - Intergenic
1063279727 10:4614108-4614130 ATTTCAGAATGATATAAAGATGG + Intergenic
1063604490 10:7510183-7510205 TTTCCAGAATGTCGTATAGTTGG + Intergenic
1063677700 10:8156049-8156071 TTTCCAGAATGTCATATAATTGG + Intergenic
1064206010 10:13324145-13324167 TTTGCAGAATGTCATGCAGTTGG + Intronic
1064366140 10:14709845-14709867 TTTTCAGAATGTCGTATATTTGG - Intronic
1064369677 10:14740378-14740400 TTTCCAACATGTCATAAAGTTGG - Intronic
1064582055 10:16804739-16804761 TTTCCAGAATGTCATATAGCTGG - Intronic
1065469093 10:26058207-26058229 TTTCTAGAATGTGATAAAGTTGG + Intronic
1066161903 10:32742559-32742581 TTTTCAGAATGTCTAACAGTTGG + Intronic
1067017171 10:42766665-42766687 TTTCCAGAATGTTATATAGTTGG - Intergenic
1067076347 10:43187111-43187133 TTTCCAGAATGTCATATAGTTGG + Intergenic
1067144030 10:43680654-43680676 CTTTGAGAATGTCATATAAATGG + Intergenic
1067266617 10:44751242-44751264 TTTCCAGAATGTCAGATAGTTGG - Intergenic
1067320435 10:45215312-45215334 TTTCCAGAATGTCATATAGTTGG - Intergenic
1067420669 10:46142980-46143002 CTTTTAGAGTGGAATAAAGTTGG + Intergenic
1067425352 10:46206553-46206575 CTTTTAGAGTGGAATAAAGTTGG - Intergenic
1067490459 10:46695124-46695146 CTTTTAGAGTGGAATAAAGTGGG + Intergenic
1067506009 10:46849449-46849471 CTTTTAGAGTGGAATAAAGTGGG + Intergenic
1067604203 10:47645241-47645263 CTTTTAGAGTGGAATAAAGTGGG - Intergenic
1067782165 10:49216226-49216248 TTTCCAGAATGTCATATAGCTGG - Intergenic
1067816633 10:49482584-49482606 CATTCAGAATGTGAGAAAGATGG - Intronic
1067857598 10:49808892-49808914 CTTCCACAATGTCATATAGTTGG - Intergenic
1068119135 10:52768343-52768365 CATTCAGAATCTCATCAAGGAGG - Exonic
1068156327 10:53204628-53204650 TTTGCAGAATGTGATATAGTTGG - Intergenic
1068590859 10:58851675-58851697 TTTCCAGAATGTTATAGAGTTGG - Intergenic
1068645998 10:59469061-59469083 TTTCCAGAATGTCATACAATTGG - Intergenic
1068689676 10:59903080-59903102 TTTCCAGAATGTCATATAGTTGG - Intronic
1068696645 10:59974894-59974916 TTCTCAGAATGTCATACAGTTGG + Intergenic
1068807841 10:61219561-61219583 TTTTCAGAATGTCACATAGTTGG + Intergenic
1068975625 10:63006135-63006157 TTTCCAGAATGTCGTATAGTTGG - Intergenic
1069240082 10:66128573-66128595 CTTCCAGAATGTCATATAGTTGG - Intronic
1069586843 10:69612141-69612163 TTTCCAGAATGTCATATAATTGG - Intergenic
1069676272 10:70250664-70250686 ATTTCAGAATGTCATGTAGATGG - Exonic
1069801374 10:71084011-71084033 CTTTCCCAAAGTCACAAAGTGGG - Intergenic
1069973472 10:72193397-72193419 TTTTGAGAATGTCATATAGATGG - Intronic
1070594511 10:77822849-77822871 TTTCCAGAATGCCATAGAGTTGG - Intronic
1070887436 10:79916460-79916482 CTTTTAGAGTGGAATAAAGTTGG + Intergenic
1071148549 10:82604262-82604284 TTTCCAGAATGTCATACAGTTGG + Intronic
1071349557 10:84726442-84726464 TTTCCAGAATGCCATATAGTTGG + Intergenic
1071704842 10:87986720-87986742 TTTTCAAAATGTCATATAGTTGG - Intergenic
1072039804 10:91596061-91596083 TTCCCAGAATGTCATATAGTTGG + Intergenic
1072076290 10:91977308-91977330 TTTCCAGAATGTCATATAGTTGG + Intronic
1072116031 10:92371153-92371175 TTTCCAGAATGTTATATAGTTGG - Intergenic
1072256186 10:93622701-93622723 TTTCCAGAATGCCATATAGTTGG + Intronic
1072292804 10:93980207-93980229 TTTCCAGAATGTCATATAGTTGG + Intergenic
1072322159 10:94261215-94261237 TTTCCAGAATGTCATATAGTTGG + Intronic
1072385062 10:94916353-94916375 TTTCCAGTATGTCATATAGTTGG - Intergenic
1072571431 10:96661226-96661248 TTTCCAGAATGTCATATAGTTGG - Intronic
1072851510 10:98898498-98898520 TTTCCAGAATGTCATATATTTGG - Intronic
1073166491 10:101458286-101458308 TTTTCAGAATGTCATATAAATGG - Intronic
1073638538 10:105224305-105224327 TTTCCAGAATGTCATATAGTTGG + Intronic
1073858793 10:107711702-107711724 CTTGCAGAAGGTAATGAAGTTGG - Intergenic
1073876786 10:107932989-107933011 CTTTCTTAATGTCACAAAATTGG - Intergenic
1073925896 10:108514866-108514888 TTTTCAGAATATCATATAATTGG + Intergenic
1074230988 10:111534999-111535021 CTTTCCCAAGGTCATAAAGCGGG - Intergenic
1074260111 10:111844703-111844725 TTTCCAGAATGTCATTTAGTTGG + Intergenic
1074629591 10:115236967-115236989 TTTCTAGAATGTCATAAAGCTGG + Intronic
1075054995 10:119211342-119211364 ATTTCAGAATCTCAGAAAATTGG + Intronic
1075162588 10:120037627-120037649 CTTTCAGCATGGCATCAAGAAGG - Intergenic
1075175808 10:120159750-120159772 CTTCCAGAATGTCATATAGTTGG + Intergenic
1075354954 10:121763523-121763545 TTTCCAGAATGTCATAAAATTGG - Intronic
1075381987 10:122026696-122026718 TTTCCAGAATGTCATACGGTTGG + Intronic
1075770680 10:124932033-124932055 TTTCTAGAATGTCATATAGTTGG + Intergenic
1076341459 10:129749354-129749376 CTTCCAGAATGTCATCTAGTTGG + Intronic
1076370239 10:129948327-129948349 TTTTCAGAATGTTGTAGAGTTGG - Intronic
1076498906 10:130919483-130919505 TTTCCAGAATGTCATATAATTGG + Intergenic
1076564353 10:131387861-131387883 TTTCCAGAATGTCCTAGAGTTGG + Intergenic
1076609345 10:131711429-131711451 ATTTCAAAATGTTATAAAGTGGG + Intergenic
1076621958 10:131795042-131795064 TTTCCAGAATGTCATATGGTTGG + Intergenic
1077732365 11:4745826-4745848 TTTCCAGGATGTCATATAGTTGG + Intronic
1077951566 11:6963280-6963302 TTTTCAGAATGTGATATAGGTGG + Intronic
1078890893 11:15557925-15557947 TTTTCAGAATGTCCTATAGTTGG - Intergenic
1078947672 11:16088524-16088546 TTTCCAGAATGTCACATAGTTGG + Intronic
1079123498 11:17701821-17701843 TTTCCAGAATGTCCTATAGTTGG + Intergenic
1079316743 11:19413894-19413916 CCTTCAGAATCTTATAAAGCAGG - Intronic
1079596057 11:22248515-22248537 CTTTCAGGATCTCAGAAAGCAGG - Intronic
1079624984 11:22606430-22606452 TTTCCAGATTGTCATATAGTTGG - Intergenic
1079780402 11:24595163-24595185 TTTTCAGAATCTAATAGAGTTGG - Intronic
1079868968 11:25771701-25771723 TTTCCAGAATGTCATATAGTTGG - Intergenic
1079963620 11:26953652-26953674 TTTCCAAAATCTCATAAAGTAGG + Intergenic
1079969146 11:27015304-27015326 CTAACAGAATATCATAAAGTAGG + Intergenic
1079980584 11:27147603-27147625 TTTCCAGAATGTCGTATAGTTGG - Intergenic
1080397781 11:31905816-31905838 TTTCCAGAATGTCATATAATTGG + Intronic
1080453588 11:32398845-32398867 TTTTCAGAATGTCATATAGTTGG - Intronic
1080473346 11:32567387-32567409 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1080484532 11:32691385-32691407 TTCCCAGAATGTCATATAGTTGG + Intronic
1080650199 11:34216387-34216409 TTTTAAGAATGTCATATAGTTGG + Intronic
1080769696 11:35329171-35329193 TTTCCAGAATGTCATATAGTTGG - Intronic
1080938581 11:36888075-36888097 TTCCCAGAATGTCATATAGTTGG - Intergenic
1081293688 11:41359111-41359133 TTTTCAGAATGTCATGTAGTTGG - Intronic
1081301091 11:41452625-41452647 AATTCAGAATTTCATAAACTGGG - Intronic
1081628856 11:44673711-44673733 GTTCCAGAATGTCATATAGTTGG - Intergenic
1081651884 11:44829405-44829427 TTTCCAGAATGTCATATAATTGG + Intronic
1081704747 11:45175356-45175378 TTTCCAGAATGTCATATAGTTGG + Intronic
1081727517 11:45341440-45341462 CTTCCAGAATGTCATGTAGTTGG - Intergenic
1081820683 11:45991100-45991122 TTTCCAGAATGTCATAGAGTTGG + Intronic
1081839919 11:46192570-46192592 TTTCCAGAATGGCATATAGTTGG - Intergenic
1081880837 11:46450327-46450349 TTTCCAGAATCTCATACAGTTGG - Intronic
1082130196 11:48479178-48479200 TTTCCAGAATGCCATATAGTTGG + Intergenic
1082246911 11:49934493-49934515 TTTCCAGAATGCCATATAGTTGG - Intergenic
1082258583 11:50059807-50059829 CATTCAGAAAGTCACAAAATAGG + Intergenic
1082563722 11:54650087-54650109 TTTCCAGAATGCCATATAGTTGG + Intergenic
1083052006 11:59785764-59785786 CTTGTAAAATGTCATACAGTAGG - Intronic
1083100048 11:60293686-60293708 TTTCCAGAAAGTCATACAGTTGG + Intronic
1083377344 11:62235336-62235358 TTTTCAGAATGCCATACTGTTGG + Intergenic
1083564437 11:63701251-63701273 TTTCCAGAATGTCATATAGTTGG + Intronic
1083916702 11:65750004-65750026 TTTTCAGAATGTCATGTAGTTGG + Intergenic
1084283395 11:68114807-68114829 TTTCCAGAATGTCATAGAATTGG - Intronic
1085398498 11:76220033-76220055 CCATCAGAACCTCATAAAGTGGG - Intergenic
1086037133 11:82430273-82430295 TTTGCAGAGTGTCATAGAGTTGG - Intergenic
1086066712 11:82753404-82753426 TTTCCAGAATGTCATATAGTTGG - Intergenic
1086287576 11:85266686-85266708 CTTTAAGTGTGGCATAAAGTAGG + Intronic
1086363122 11:86079895-86079917 TTTTCAGAATATCAAATAGTTGG + Intergenic
1086375712 11:86198791-86198813 TTTCCAGAATGTCATATAGCTGG - Intergenic
1086392279 11:86377009-86377031 GTTCCAGAATGTAATATAGTTGG + Intronic
1086767780 11:90719881-90719903 CTTATAGTAGGTCATAAAGTTGG - Intergenic
1086959297 11:92966403-92966425 TTTCCAGAATGTCATATAATTGG + Intergenic
1087114906 11:94514303-94514325 CTTTCACAAGCTCACAAAGTTGG + Intergenic
1087462576 11:98463621-98463643 ATGCCAGAATGACATAAAGTGGG + Intergenic
1087611637 11:100441652-100441674 TTTCCAGAAGGTCATATAGTTGG - Intergenic
1087637708 11:100721341-100721363 TTCCCAGAATGTCATACAGTTGG + Intronic
1087947612 11:104183130-104183152 TCTCCAGAATGTCATATAGTTGG - Intergenic
1088028269 11:105213954-105213976 CTTGCAGAATGTCATATAGTTGG - Intergenic
1088163139 11:106898622-106898644 TTTCCAGAATGTTATATAGTTGG - Intronic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1088334298 11:108686454-108686476 TTTTCAGAATGTTGTATAGTTGG + Intronic
1088457249 11:110045700-110045722 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1088677497 11:112209315-112209337 TTTCCAGAATGTCACATAGTTGG + Intronic
1088704143 11:112446507-112446529 TTTCCAGAATGTGATATAGTTGG + Intergenic
1088925831 11:114301539-114301561 TTTCCAGAATGTCATATAGTTGG - Intronic
1088931623 11:114357026-114357048 CTTCCAGAATGTCATATAGTTGG + Intergenic
1089803227 11:121056198-121056220 TTTCCAGAATGTCATCTAGTTGG + Intronic
1090219492 11:125005777-125005799 TTTCCAGAACGTCATATAGTTGG + Intronic
1091096563 11:132828168-132828190 TTTCCAGAATGTCATACAGTTGG - Intronic
1091320673 11:134647132-134647154 CTTTCAGAGTGCTCTAAAGTTGG + Intergenic
1091392224 12:132548-132570 CTTCCAGAATGTCACCACGTAGG - Intronic
1091891985 12:4063817-4063839 TTTCCAGAATATCATATAGTTGG + Intergenic
1091923884 12:4328156-4328178 CATTCAGAATCTTATAAAATGGG - Intronic
1091939167 12:4460738-4460760 TTTCCAGAATGTCATATAGTTGG - Intergenic
1092038879 12:5365927-5365949 TTTCCAGAATGTCATATAGTAGG - Intergenic
1092361714 12:7842110-7842132 TTTCCAGAATGTCATACAGTTGG + Intronic
1092376292 12:7958229-7958251 TTTCCAGAATGTCATACAGTTGG + Intergenic
1092646333 12:10577623-10577645 TTTACAGAATGTCATATAGTTGG - Intergenic
1092699423 12:11210968-11210990 TTTCCAGAATGTCATAGAGTTGG - Intergenic
1093109588 12:15133310-15133332 TTTCCAGAATGTCATATAGTTGG + Intronic
1093235070 12:16599975-16599997 CGTTTAGAATGTCATGAGGTGGG + Intronic
1093312159 12:17602229-17602251 CTTTTAGAATGTCATTATGAGGG - Intergenic
1093357468 12:18185169-18185191 TTTTCAGAATGTCATGTAGCTGG + Intronic
1093540985 12:20284586-20284608 CTTTCAGAAAGTCATGTAGTTGG + Intergenic
1093738165 12:22648437-22648459 TTTTCAGAATGTCATATATTTGG + Intronic
1094145482 12:27224453-27224475 TTTCCAGAATGTGATATAGTTGG - Intergenic
1094236401 12:28172103-28172125 CTATCAAAATTACATAAAGTGGG - Intronic
1094432349 12:30383393-30383415 TTTTCAGAATGTCATAAGGTTGG - Intergenic
1095277111 12:40299509-40299531 CTTCCAGAATGTCTTATAGTTGG - Intronic
1095509503 12:42934953-42934975 TTTCTAGAATGTCATATAGTTGG + Intergenic
1095522753 12:43086372-43086394 TTTCCAGAATGTCATATAGTTGG - Intergenic
1095692438 12:45105426-45105448 TTTCCAGAATGTTATATAGTTGG + Intergenic
1095763777 12:45870677-45870699 TTTCCAGAATGTAATATAGTTGG + Intronic
1095780162 12:46049894-46049916 CTTTCAGAATGTTTTATATTGGG - Intergenic
1095999507 12:48117087-48117109 TTTCCAGACTGTCATACAGTTGG + Intronic
1096076176 12:48806549-48806571 TTTTCAGAATGTCCTATAGTTGG - Intergenic
1096174684 12:49505947-49505969 CTTTCATACCATCATAAAGTTGG - Intronic
1096564320 12:52464686-52464708 TTTCCAGCATGTCATATAGTTGG - Intergenic
1096568437 12:52501045-52501067 TTTTCAAAATGTCATGTAGTTGG + Intergenic
1096891104 12:54772233-54772255 TTTCCAGAATGTGATATAGTTGG + Intergenic
1097256471 12:57679611-57679633 TTTCCAGAATGTCACATAGTTGG - Intergenic
1097291760 12:57922573-57922595 TTACCAGAATGTCATATAGTTGG - Intergenic
1097308556 12:58094701-58094723 CTTGCCTAATGTCATACAGTTGG + Intergenic
1097504604 12:60449837-60449859 ATTTCATAATGTCGTAAAGTTGG + Intergenic
1097571736 12:61341737-61341759 TTTTCAGAATGTCATCTAATTGG + Intergenic
1097989145 12:65816693-65816715 CTTTCTAGATTTCATAAAGTTGG - Intergenic
1098373179 12:69781593-69781615 TTTCCAGATTGTCATAGAGTTGG + Intronic
1098462857 12:70752052-70752074 TTTCCTGAATGTCATATAGTTGG + Intronic
1098499338 12:71172017-71172039 CTTACAAAATGTCATACAATTGG + Intronic
1098776365 12:74624629-74624651 GTTCCAGAATGGCATATAGTTGG - Intergenic
1098807507 12:75038032-75038054 TTTCCAGAATGTCATATAGTTGG - Intergenic
1098833193 12:75388561-75388583 TTTCCAGAATGTCATATAGTTGG - Intronic
1099572081 12:84335276-84335298 TTTACAGGATGTCATATAGTTGG - Intergenic
1099576168 12:84384744-84384766 TTTCCAGAATGTCATACATTTGG + Intergenic
1099634092 12:85191385-85191407 TTTCCAGAATGTCACATAGTTGG + Intronic
1099762112 12:86937306-86937328 TTTCCAGAATGTCATATAGTTGG - Intergenic
1100143257 12:91644528-91644550 TTCCCAGAATGTCATATAGTTGG + Intergenic
1100322636 12:93510162-93510184 TTTTCAGAACGCCATATAGTTGG + Exonic
1101038670 12:100731714-100731736 TTTCCAGAATGTCACATAGTTGG + Intronic
1101133780 12:101718047-101718069 TTTAAAGAATGTCATATAGTTGG - Intronic
1101163243 12:102001213-102001235 TTTCCAAAATGTCATATAGTTGG + Intronic
1101355662 12:103975381-103975403 GTTTCAGAATGCCATAGACTGGG + Intronic
1101430997 12:104627063-104627085 TTTCCAGAATGTCATATAGTTGG + Intronic
1101432734 12:104640498-104640520 TTTACAGAATGTCATATAGTTGG - Intronic
1101540073 12:105657076-105657098 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1101795966 12:107974210-107974232 CATTCATAATATCAAAAAGTGGG - Intergenic
1102325583 12:111980340-111980362 TTTTTAGAATGTCATATAATGGG - Intronic
1102479999 12:113216299-113216321 TTGCCAGAATGTCATATAGTTGG - Intronic
1102720461 12:115011630-115011652 TTTTGAGAATGTCATGTAGTTGG + Intergenic
1102741331 12:115210103-115210125 CTTTCAGAATCTGATAAATGGGG - Intergenic
1102811719 12:115829963-115829985 CTTCCAGAATGTCACATAGTGGG + Intergenic
1102811974 12:115832228-115832250 TTTCCAGAATGTCACATAGTTGG + Intergenic
1103208260 12:119147234-119147256 TTTCCAGAATGTCATACAGTTGG - Intronic
1103295648 12:119884367-119884389 TTTCCAGAATGTCATATAGTTGG + Intergenic
1103720309 12:122970936-122970958 TTTCCAGAATGTCATATGGTAGG - Intronic
1103879635 12:124156131-124156153 TTTCCAGAATGTCATATAGCTGG + Intronic
1103964244 12:124628170-124628192 TTTCCAGAATGTCACATAGTTGG + Intergenic
1104080459 12:125425668-125425690 TTTCCAGAATGTCGTATAGTTGG + Intronic
1104148995 12:126063839-126063861 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1104168068 12:126253171-126253193 TTTGCAGAATGTCCTAGAGTTGG - Intergenic
1104496497 12:129245274-129245296 TTTCCAGAATGTCATATACTTGG + Intronic
1104737399 12:131144649-131144671 ATCCCAGAATGTCATATAGTTGG + Intergenic
1105054785 12:133088332-133088354 GTTCCAGAATGTCAGAGAGTTGG + Intronic
1105205900 13:18223601-18223623 TTTCCAGAATGTCGTATAGTTGG + Intergenic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1105311029 13:19211322-19211344 TTTCCAGAATGTCATATAGTTGG - Intergenic
1105319638 13:19305954-19305976 TTTCCAGAATGTCATATAGTTGG - Intergenic
1105361254 13:19718895-19718917 TTTCCAGAATGTCATATAGTTGG - Intronic
1105386178 13:19931538-19931560 TTTCCAGAATGTCATATAGTTGG + Intergenic
1105546974 13:21357880-21357902 TTTCCAGAATGTCATACAGTTGG - Intergenic
1105643764 13:22294402-22294424 TTTCCAGAATATCATAAAGTTGG + Intergenic
1105834959 13:24201920-24201942 TTTCCAGAATGTCATGTAGTTGG + Intronic
1106057242 13:26250035-26250057 CTTTCAGAAGGTTATAAGGAGGG - Intergenic
1106109754 13:26766370-26766392 TTTCCAGAATGTCATAGAATTGG + Intergenic
1106192984 13:27470388-27470410 TTTCCAGAATGTTATATAGTAGG - Intergenic
1106461159 13:29970439-29970461 TTTCCAGAATGTCATATGGTTGG + Intergenic
1106489216 13:30201884-30201906 TTTCCAGAATGTCATATAGTTGG - Intergenic
1106637126 13:31541157-31541179 TTTCCAGAATGTCCTATAGTTGG - Intergenic
1106710128 13:32322210-32322232 TTTCCAGAATGTCATGTAGTTGG + Intronic
1106771442 13:32964456-32964478 TTCCCAGAATGTCATATAGTTGG + Intergenic
1106790307 13:33148981-33149003 CTTTTAGAATGCTATATAGTTGG - Intronic
1106830785 13:33580318-33580340 TTTTCAGAATGTTATATAGTTGG - Intergenic
1106939296 13:34759440-34759462 TTTCCAGAATCTCATATAGTTGG + Intergenic
1107234369 13:38151315-38151337 TTTCCAAAATGTCATATAGTTGG - Intergenic
1107257215 13:38442254-38442276 TTTCCAAAATGTCATATAGTTGG + Intergenic
1107663955 13:42669969-42669991 TTTCTAGAATGTCATATAGTTGG - Intergenic
1107785195 13:43948684-43948706 TTTCCAGAATGTCATATAGTTGG - Intergenic
1107961182 13:45560680-45560702 TTTCCAGAATGTCATATAGTAGG + Intronic
1107978831 13:45715021-45715043 TTTTCAGAATGTCATATAGTTGG + Intergenic
1108075186 13:46672106-46672128 TTTCCAGAATGTCATGTAGTTGG + Intronic
1108119224 13:47165002-47165024 TCTCCAGAATGTCATACAGTTGG - Intergenic
1108217208 13:48196976-48196998 TTTCCAGAATGTCATATAGTTGG + Intergenic
1108316094 13:49239062-49239084 TTTCTAGAATGTCATATAGTTGG - Intergenic
1108392970 13:49966016-49966038 TTTCCAGAATGTCATATAGTTGG - Intergenic
1108457132 13:50627767-50627789 TTTCCAGAATGTCATATAGTTGG - Intronic
1108531794 13:51333951-51333973 GTTCCAGAATGTCATTTAGTTGG - Intergenic
1108580872 13:51827229-51827251 CTTTCCCAATGTCTAAAAGTTGG - Intergenic
1108963518 13:56267205-56267227 TTTTCAGAATGCCATATAATTGG - Intergenic
1109087399 13:57992390-57992412 TTTTCAGAGTGTCATGTAGTTGG + Intergenic
1109093852 13:58085727-58085749 TTTTCATGATGTCATAAAGAAGG - Intergenic
1109161376 13:58979028-58979050 CTTTGTGAATTTCATAAGGTTGG - Intergenic
1109413829 13:62009360-62009382 TTTTCAGAATGTCATACAGTTGG + Intergenic
1109570978 13:64189505-64189527 TTTTCAGAATGTCATATAATTGG - Intergenic
1109602295 13:64647696-64647718 TTTTCAAAGTGTCATATAGTTGG - Intergenic
1109604108 13:64669554-64669576 ATTTAATTATGTCATAAAGTTGG - Intergenic
1109812714 13:67536587-67536609 CTTTCAAAATGTCATACAAATGG - Intergenic
1109820346 13:67644391-67644413 ATTTCAGACTGTTATAAAATAGG + Intergenic
1109916460 13:68992123-68992145 TTTTCAGAATGTCACATAATTGG + Intergenic
1110020780 13:70468396-70468418 CATCCAGAATGTGATAAAATAGG - Intergenic
1110186762 13:72683859-72683881 TTTCCAGAATGCCATATAGTTGG + Intergenic
1110440095 13:75518092-75518114 TTTCCAGAATATCATATAGTTGG - Intergenic
1110458636 13:75718859-75718881 TTTCCAGAATGTCACATAGTTGG + Intronic
1110831775 13:80040195-80040217 GTGTCAGATTTTCATAAAGTAGG + Intergenic
1110903336 13:80853134-80853156 TTTCCAGAATGTCATATAGTTGG + Intergenic
1111113582 13:83747993-83748015 TTTTCAGAATGTCATATCATTGG - Intergenic
1111129330 13:83954410-83954432 TTTCCAGGATGTCATATAGTTGG - Intergenic
1111228595 13:85310054-85310076 TTCTGAGAATGTCATATAGTTGG - Intergenic
1111264344 13:85787904-85787926 TTTCTAGAATGTCATAGAGTTGG - Intergenic
1111314972 13:86543680-86543702 TTTCCAGAATGTCATATAGTTGG - Intergenic
1111477377 13:88769369-88769391 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1111482049 13:88842473-88842495 TTTCCAGAATGTCATATAGTTGG - Intergenic
1111689860 13:91550163-91550185 TTTCCAGAATGTCATACAGTTGG - Intronic
1112153205 13:96786946-96786968 TTTTCAGAATGTCCTAAATTTGG + Intronic
1112679821 13:101750955-101750977 TTTCCAGAATGTTATATAGTTGG - Intronic
1113489729 13:110681845-110681867 TTTCTAGAATGTCATATAGTTGG - Intronic
1113873031 13:113574355-113574377 TTTCTAGAATGTCATAGAGTTGG - Intergenic
1114169889 14:20261718-20261740 TTTTCAGAATGTCATAAAATTGG - Intronic
1114239397 14:20852361-20852383 TTTCCAGAATGTCATATAGTTGG - Intergenic
1114293139 14:21305273-21305295 CTTCTAGAATGTCATATAGTTGG + Intronic
1114358624 14:21943781-21943803 TTTCCAGAATGTCATATACTTGG + Intergenic
1114389557 14:22292254-22292276 TGTTCAGAATGTTATATAGTTGG - Intergenic
1114591761 14:23872012-23872034 TTTCCAGGATGTCATATAGTTGG - Intergenic
1114868517 14:26628034-26628056 TTTTCAGAATGTCATATAATTGG - Intergenic
1115269170 14:31532507-31532529 ATTTCAGAATGTCATGAAGTTGG + Intronic
1115640082 14:35330064-35330086 TTTCCAGAAAGTCATATAGTTGG - Intergenic
1115813561 14:37136827-37136849 TTTCCAGAATGTCTTACAGTTGG - Intronic
1115833962 14:37376380-37376402 TTTCCAGAATGTCATATAGTTGG + Intronic
1116356188 14:43934714-43934736 TTTTCAGCATGTCATATAGTTGG - Intergenic
1116429892 14:44834210-44834232 GATTTACAATGTCATAAAGTAGG + Intergenic
1116617657 14:47158964-47158986 TTTCCAGAATGTCATATATTTGG - Intronic
1116902408 14:50374192-50374214 TTTCCAGAATGTCATAGAATTGG - Intronic
1116914634 14:50511816-50511838 TTTTCGGAATGTCATAGAGTTGG - Intronic
1116981854 14:51179609-51179631 CATTCAGAAGGTCATTCAGTAGG + Intergenic
1117085680 14:52197808-52197830 TTTCCAGAATGTCATATAGTTGG - Intergenic
1117421677 14:55552720-55552742 CTTCCAAAATGTCATATAGTCGG - Intergenic
1117533484 14:56681792-56681814 TTTACAGAATGTCATATAGATGG + Intronic
1117607561 14:57445715-57445737 TTTCCAGAATGTCATATGGTTGG + Intergenic
1117698587 14:58391339-58391361 TTTCCAGAATGTCATATATTTGG - Intergenic
1117752844 14:58941339-58941361 CTTTCATAAGGTCTTAAAGGTGG + Intergenic
1117763144 14:59053625-59053647 TTTCCAGAATGTCATATAGTTGG - Intergenic
1117787781 14:59305009-59305031 CTTTCAGAATGTCATAAAGTAGG - Intronic
1117801885 14:59453001-59453023 TTTCCAGAATGTCATATAGTTGG - Intronic
1117928021 14:60805625-60805647 TTTCCAGAATGTTATATAGTTGG + Intronic
1118048410 14:61998414-61998436 TTTTCAGAATGTCATATAAATGG + Intronic
1118095100 14:62527655-62527677 TTTCCAGAATGTCATATGGTTGG - Intergenic
1118177083 14:63451483-63451505 TTTCCAGACTGTCATATAGTTGG - Intronic
1118534771 14:66749074-66749096 TTTCCAAAATGTCATATAGTTGG + Intronic
1118826952 14:69392444-69392466 TTTCCAGAATGTCATATAGTTGG - Intronic
1119197704 14:72729696-72729718 CTTCCAGGATGTCATATACTTGG - Intronic
1119280180 14:73400197-73400219 TTTCCAGAATGTCATATAGTTGG - Intronic
1119737092 14:76989780-76989802 TTTCCAGAATGTCATATAGTTGG + Intergenic
1119845043 14:77822830-77822852 CTGTCAGACTGTCATCAAGCTGG + Intronic
1120464541 14:84839851-84839873 TTTCCAGAATGTCATTTAGTTGG - Intergenic
1120580923 14:86247562-86247584 TTTCCAGAGTGTCATATAGTTGG - Intergenic
1120658468 14:87224539-87224561 TTTCCAGAATGTCATATAGTTGG - Intergenic
1120737866 14:88075628-88075650 TTTCCAGAATGTCATATAGTTGG - Intergenic
1120908073 14:89638386-89638408 CTTCCAGAATGTCGTATAGTTGG - Intronic
1121290091 14:92767198-92767220 TTTCCAGAATGTCATATAGTTGG + Intergenic
1121291127 14:92776394-92776416 TTTCCAGAATGTCATATAGTTGG - Intergenic
1121301197 14:92872682-92872704 TTTCCAGAATGTCATATAGTTGG - Intergenic
1121301330 14:92873832-92873854 TTTCCAGAATGTCATATAGTTGG - Intergenic
1121473157 14:94172759-94172781 ATTTCAGATTGACATAAATTAGG + Intronic
1121480974 14:94273384-94273406 TCTCCAGAATGTCATATAGTTGG - Intronic
1121819593 14:96955577-96955599 TTTTCAGAATGTTATATGGTTGG - Intergenic
1121885354 14:97537988-97538010 TTTCCAGAATGTCAGATAGTTGG - Intergenic
1122808151 14:104271239-104271261 TTTCCAGAAAGTCATACAGTTGG + Intergenic
1122851353 14:104533635-104533657 TTTTCAGAATGTCATATATTTGG + Intronic
1123800783 15:23818146-23818168 TTTTCAGAATGTCATATAAATGG + Intergenic
1124402835 15:29365133-29365155 TTTCCAGAATGTCATATGGTTGG + Intronic
1124429827 15:29597188-29597210 TTTCCAGAATGTCATATAGTTGG + Intergenic
1124462512 15:29905789-29905811 TTTCCAGAATGTCAGATAGTTGG - Intronic
1125060316 15:35412750-35412772 TTTCCAGAATGTCATATAGTTGG - Intronic
1125066976 15:35499284-35499306 CTTTCAGAACTTCAGAAAGGAGG + Intronic
1125278784 15:38022418-38022440 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1125734241 15:41912392-41912414 CTTTCAGAAGTTCATCAAGTTGG + Intronic
1125779764 15:42254627-42254649 TTTCCAGAATGTCATCTAGTTGG - Intronic
1125868979 15:43080426-43080448 TTTCCAAAATGTCATACAGTTGG + Intronic
1126379666 15:48033370-48033392 TTTCCAGAAGGTCATAAAGTTGG - Intergenic
1126596199 15:50386447-50386469 TTTCCAGAATGTCATATAGTTGG - Intergenic
1126641936 15:50836432-50836454 TTTTCAGAATATCACATAGTTGG + Intergenic
1126861460 15:52886934-52886956 TTTACAGAATGTCATATGGTTGG + Intergenic
1127150967 15:56075069-56075091 GTTCCAGGATGTCATACAGTTGG - Intergenic
1127259122 15:57315227-57315249 TTTCCAGAATGTCATCTAGTTGG + Intergenic
1127739558 15:61888624-61888646 TTTTCAGAATTTCATATAGTTGG - Intronic
1127813088 15:62581218-62581240 CTTCCAGAATGTCATCGAGTTGG + Intronic
1127834426 15:62778992-62779014 CTCTCAGAATTTCATTAATTTGG + Intronic
1128463057 15:67885662-67885684 TTTCCAGAATGTCATATAGTCGG + Intergenic
1128588319 15:68871568-68871590 TTTCCAGAATGTCATATAGCTGG + Intronic
1128929200 15:71689095-71689117 CTTTCAGAATCTCATTGAGGAGG - Intronic
1128934575 15:71734420-71734442 TTTCTAGAATGTCATATAGTTGG - Intronic
1128953187 15:71908975-71908997 TTTCCAGAATGTCATATATTTGG + Intronic
1128967902 15:72078892-72078914 TTTCCAGAATGTCATGTAGTTGG - Intronic
1129065228 15:72897476-72897498 TTTCCAGAATGTCATATAGCTGG + Intergenic
1129582070 15:76821926-76821948 TTTTCAGAATGTTGTATAGTTGG - Intronic
1129632578 15:77277777-77277799 TTTTCAGAATGTCATATAGTTGG - Intronic
1129637755 15:77340387-77340409 TTTTCAGACTGTCATGTAGTTGG - Intronic
1129936557 15:79455593-79455615 CTTCCAGAATGTCATTAAGATGG + Intronic
1129996693 15:80012820-80012842 TTTCTAGAATGTCATATAGTTGG + Intergenic
1130010057 15:80145027-80145049 TTTCCAGAATGTCATATAATTGG - Intergenic
1130163849 15:81431944-81431966 TTTCCAGAATGTCATATAGTTGG + Intergenic
1130165164 15:81448395-81448417 TTTCCAGAATGTCATATTGTTGG - Intergenic
1130178321 15:81598068-81598090 TTTCCAGAATGTCATAGACTTGG + Intergenic
1130204633 15:81864679-81864701 TTTCCAGAATGTCATATAGTTGG - Intergenic
1130293685 15:82626975-82626997 CTTTCTGTGTATCATAAAGTAGG + Intronic
1130741649 15:86607032-86607054 TTTCCAGAATGTCATATAGTTGG + Intronic
1130950789 15:88585819-88585841 TTTCTAGAATGTCATACAGTTGG - Intergenic
1131320060 15:91379899-91379921 TTTCCAGAATGTCATATAGTTGG + Intergenic
1131363198 15:91813521-91813543 TTTCCAGAATGTCATATAATTGG - Intergenic
1131588607 15:93722745-93722767 TTTTGAGAATGTCATAAAAATGG + Intergenic
1131633404 15:94203913-94203935 TTTCCAGAATGTCATATAGTTGG - Intergenic
1131892424 15:96986046-96986068 TTTTCAGAATGTCATGTAGTTGG + Intergenic
1131964157 15:97821021-97821043 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1132509503 16:331326-331348 CCCTGAGAATGTCATAAAGAGGG - Intronic
1132954053 16:2581622-2581644 ATTTCAGAAGATCATTAAGTTGG + Exonic
1132960292 16:2618541-2618563 ATTTCAGAAGATCATTAAGTTGG - Intergenic
1133238327 16:4399978-4400000 TTTCCAGAATGTCATATAGTTGG - Intronic
1133842966 16:9427122-9427144 TTTTCAGAACGTCACAGAGTTGG + Intergenic
1133920968 16:10152860-10152882 TTTCCAGAATGTCATATAGTTGG - Intronic
1134009071 16:10837956-10837978 TTTCCAGAATGTCATAGAGTTGG - Intergenic
1134085204 16:11352132-11352154 TTTCCAGAATATCATATAGTTGG + Intergenic
1134098784 16:11437085-11437107 TTTCCAGAATGTCATAGAGTTGG - Intronic
1134113631 16:11531829-11531851 TTTCCAGAATGTCACAGAGTTGG + Intergenic
1134388150 16:13793644-13793666 CTTTCTCAATGTCATAGAGCTGG + Intergenic
1134505705 16:14805175-14805197 ATTTCAAAATCTCATAAAGAAGG - Intronic
1134574876 16:15323772-15323794 ATTTCAAAATCTCATAAAGAAGG + Intergenic
1134645649 16:15863381-15863403 CTTCCAGAATGTTGTATAGTTGG - Intergenic
1134727571 16:16432702-16432724 ATTTCAAAATCTCATAAAGAAGG - Intergenic
1134772241 16:16819368-16819390 TTTCCAGAATGTCATAGAGCTGG + Intergenic
1134939864 16:18279125-18279147 ATTTCAAAATCTCATAAAGAAGG + Intergenic
1135690541 16:24533822-24533844 TTTCTAGAATGTCATATAGTTGG - Intergenic
1135825304 16:25722009-25722031 CTTTCAGAGTTTAATAAAATAGG - Intronic
1135847923 16:25935536-25935558 TTTCCAGAATGTCATATAGTTGG + Intronic
1135854011 16:25989997-25990019 TTTTCAGAATGACATATAGTTGG + Intronic
1135939085 16:26805444-26805466 TTTTCACAATGTCATAGAATTGG - Intergenic
1136932108 16:34428210-34428232 TTTTCAGAATGTCAAATAGTTGG - Intergenic
1136972464 16:34983605-34983627 TTTTCAGAATGTCAAATAGTTGG + Intergenic
1137443749 16:48519223-48519245 TTTCCAGAATGTCATATAGTTGG - Intergenic
1137628723 16:49927020-49927042 TTTCCAGAATGTCATAGAGTTGG - Intergenic
1137657507 16:50172876-50172898 TTTACAGAATGTCATATAGTTGG + Intronic
1137692591 16:50439887-50439909 TTTTCAGAATGTCATATCATTGG - Intergenic
1138141512 16:54572553-54572575 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1138306701 16:55983496-55983518 CTTTCAAAATGTCATATAGTTGG + Intergenic
1138356092 16:56381623-56381645 ATTCCAGAATGTCATACAGGTGG - Intronic
1138964637 16:62069282-62069304 CTTCTAGAATGTCATATAGTTGG + Intergenic
1138986323 16:62333239-62333261 CTTTTACATTGTCATAAAGTGGG - Intergenic
1139070148 16:63370369-63370391 TTTCCAGAATGTCATCTAGTTGG + Intergenic
1139082890 16:63546996-63547018 TTTCCAGAATATCATAGAGTTGG + Intergenic
1139498112 16:67336059-67336081 TTTTCAGAATGTCATATAGTTGG + Intronic
1139499982 16:67354978-67355000 TTTCCAGAATGTCATATAGTTGG + Intronic
1139721257 16:68857217-68857239 CCTCCAGAATGTCATGTAGTTGG + Intronic
1140335369 16:74099924-74099946 TTTCCAGAATGTCATATAGTTGG - Intergenic
1140462730 16:75153918-75153940 TTTCTAGAATGTCATATAGTTGG + Intronic
1140709300 16:77661639-77661661 TTTCCAGAATGTCATATAGTTGG + Intergenic
1141166313 16:81663404-81663426 TTTTCAGAATGTCCTGTAGTTGG - Intronic
1141489305 16:84361176-84361198 TTTCCAGAATGTCACACAGTTGG - Intergenic
1141670381 16:85488649-85488671 CTTTCCGGAGGTCATGAAGTTGG + Intergenic
1142821592 17:2472769-2472791 TTTCCAGAATGTCATATAATTGG - Intronic
1143255113 17:5551252-5551274 CTTCCAGAATGTCATATAGTTGG + Intronic
1143422915 17:6809708-6809730 TTTCTAGAATGTCATATAGTTGG + Intronic
1143802520 17:9396253-9396275 TTTCCAGAATGTCATATAATTGG - Intronic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1144071722 17:11680031-11680053 ATTTCAGAATGGGGTAAAGTGGG + Intronic
1144231991 17:13216710-13216732 TTTCCAGTATGTCATAGAGTTGG - Intergenic
1144373450 17:14615656-14615678 TTTTCAGAATGTCATATAGTTGG + Intergenic
1144746257 17:17616893-17616915 TTTTCAGTATGCCATATAGTTGG + Intergenic
1145059220 17:19721732-19721754 TTTGCAGAATATCATAGAGTTGG - Intergenic
1145199574 17:20931000-20931022 TTTCCAGAATGTCATATAGTTGG - Intergenic
1145229341 17:21160983-21161005 TTTCCAGAATGTCATATACTTGG - Intronic
1146009715 17:29184084-29184106 TTTGCAGAATGCCATATAGTTGG - Intergenic
1146432261 17:32808875-32808897 CTAACAAAATATCATAAAGTAGG - Intronic
1146547685 17:33753228-33753250 TTTCCAGAATGTCATATAGCTGG - Intronic
1146633486 17:34487272-34487294 ATTTCAGCATGTCACACAGTAGG + Intergenic
1146759696 17:35466372-35466394 TTTACAGAATGTCATATAGTTGG + Intronic
1147482089 17:40775624-40775646 TGTACAGAATGTCATATAGTTGG + Intergenic
1147506541 17:41023263-41023285 TTTTCAGAATGTCATATACTTGG + Intergenic
1147698156 17:42372476-42372498 TTTCCAGAATGTCATATAGTTGG - Intronic
1148034437 17:44648192-44648214 TTTACAGAATGTCATAGAATTGG - Intergenic
1148398553 17:47331792-47331814 TTTCCAGAATGTCATATAGTTGG + Intronic
1148923621 17:51062495-51062517 TTTCCAGAATGTCACATAGTGGG + Intronic
1149057746 17:52385880-52385902 TTTGCAGAATGTCGTATAGTTGG + Intergenic
1149120172 17:53153189-53153211 TTTCCAGGATGTCATATAGTTGG + Intergenic
1149125898 17:53232495-53232517 TTTTCAGAATGGCATGTAGTTGG - Intergenic
1149391351 17:56194518-56194540 TTTCCAGAAAGTCATATAGTTGG - Intronic
1149762773 17:59247444-59247466 TTTCCAGAATGTCATATAGTTGG + Intronic
1149917908 17:60628572-60628594 TTTCCAGAATGTCATATAGTTGG + Intronic
1150203667 17:63383428-63383450 TTCCCAGAATGTCATATAGTTGG + Intronic
1150688167 17:67337446-67337468 TTTTCAGAATGTCATATAGTTGG - Intergenic
1150865372 17:68843504-68843526 TTTTCAGAATGACATAAATTTGG + Intergenic
1151120131 17:71783786-71783808 CTTTCAGCAGGTCTTAGAGTTGG - Intergenic
1151150634 17:72083115-72083137 TTTTCAGAATGTCATATAGTTGG - Intergenic
1151994464 17:77600037-77600059 CTTTCAGGTGGTCTTAAAGTTGG - Intergenic
1152501408 17:80712388-80712410 TTTCCAGAATGTCCTATAGTTGG + Intronic
1152939987 17:83163720-83163742 TTTGCAGGATGTCATATAGTTGG + Intergenic
1153118834 18:1695087-1695109 TTTCCAGAATGTCATATAATTGG + Intergenic
1153120350 18:1717179-1717201 TTTCCAGAATGTCATATAGTTGG - Intergenic
1153135196 18:1909826-1909848 CTTACAGACTGTCATATAGATGG - Intergenic
1153693984 18:7621687-7621709 TTTCCAGAATGTCGTATAGTTGG + Intronic
1153703600 18:7722218-7722240 TTTCCAGAATGTCATATTGTTGG + Intronic
1153839499 18:8993436-8993458 TTTCCAGAATATCATATAGTTGG - Intergenic
1153873752 18:9346209-9346231 TTTCCACAATGTCATATAGTTGG + Intronic
1153954423 18:10083979-10084001 TTTTCAGAATGTCATATCATTGG + Intergenic
1154167240 18:12025100-12025122 TTTCCAGAATGTCATGGAGTTGG + Intronic
1154179358 18:12118278-12118300 TTTCCAGAAAGTCATATAGTTGG + Intronic
1154195256 18:12261080-12261102 ATTTCTGAATGTAAAAAAGTCGG + Intronic
1154259650 18:12819412-12819434 TTTCCAGAATGTCATAAAAATGG - Intronic
1154319313 18:13332621-13332643 TTTCCAGAATGTCATATGGTTGG + Intronic
1154337847 18:13480340-13480362 ATTCCAGAATGTCACACAGTTGG - Intronic
1154375660 18:13807489-13807511 CTTCCAGGATGTCAGAGAGTTGG - Intergenic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1154951143 18:21211048-21211070 TTTCCAGAATGTGATATAGTTGG + Intergenic
1154958180 18:21280267-21280289 TTCCCAGAATGTCATATAGTTGG + Intronic
1155275659 18:24185083-24185105 TATCCAGAATGTCATACAGTTGG - Intronic
1155373419 18:25130260-25130282 TTTGCAGAATGTCATATACTTGG - Intronic
1155417015 18:25609824-25609846 TTTCCAGAATGTCATATAGTTGG - Intergenic
1155564399 18:27117610-27117632 TTTCCAGAATGTCATATTGTTGG + Intronic
1155812692 18:30258337-30258359 TTTCCAGAATGTCATATAATTGG + Intergenic
1155858417 18:30865172-30865194 TTTCCAGAATGTCATATAGTTGG - Intergenic
1155917515 18:31571090-31571112 TTTCCAGAATGTCAGATAGTTGG - Intergenic
1155981121 18:32180902-32180924 TTTCCAGAATGCCATATAGTTGG + Intronic
1156131638 18:33983116-33983138 TTTTCAGAATGTCATTTAATTGG - Intronic
1156531232 18:37818341-37818363 TTTAGAGAATGTCATATAGTTGG - Intergenic
1156740184 18:40316700-40316722 TTTTCAGAATGTCATAAAATTGG + Intergenic
1156747088 18:40405383-40405405 CTTCCAGAATGTCATATAGTTGG + Intergenic
1156885742 18:42133392-42133414 TTTCCAGAATGTCATATAGTTGG + Intergenic
1156926660 18:42589019-42589041 TTTTTAGAATGTCATATATTTGG + Intergenic
1156978027 18:43249161-43249183 CTTTCTCAATGTCATATAATTGG - Intergenic
1157044668 18:44086907-44086929 TTTTCAGAATGTCATATAGTTGG - Intergenic
1157262900 18:46191881-46191903 TTTCCAGAATGTCATACAATTGG + Intronic
1157501227 18:48192233-48192255 TTTCCAGAATGTCATATAGTTGG - Intronic
1158636518 18:59163311-59163333 TTTCCAGTATGTCATATAGTTGG + Intergenic
1158961347 18:62590104-62590126 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1159164070 18:64681037-64681059 TTTTGATAATGTCATAGAGTTGG + Intergenic
1159373120 18:67555196-67555218 TTTCCAGAATGTCATATAGTTGG + Intergenic
1159393302 18:67823402-67823424 CTTGCAGAATGTTATACAGTTGG + Intergenic
1159409398 18:68052016-68052038 TTTCCAGAATGTCATATAGTTGG + Intergenic
1159437910 18:68442342-68442364 TTTCCAGAATGTCATATACTTGG + Intergenic
1159686668 18:71430313-71430335 CTTTCAGAATGTGAGAAAACTGG - Intergenic
1159818314 18:73105876-73105898 TTTCCAGAATGCCATATAGTTGG + Intergenic
1160114106 18:76061202-76061224 CATTCACAATGGCATAAAGGTGG - Intergenic
1161613292 19:5256052-5256074 TTTTCAGAATGTAAAAATGTGGG + Intronic
1162044915 19:7992514-7992536 CTTCCAGAAGGTCATAGAGTTGG - Intronic
1162116989 19:8436569-8436591 TTTCCAGAATGTCCTATAGTTGG + Intronic
1162247144 19:9410844-9410866 TTTTCAGAATGTCATAGAGTTGG - Intergenic
1162634962 19:11960830-11960852 ATTTCAGAATGGCAGAAAGAAGG - Intronic
1162697589 19:12488176-12488198 TTTTCAGAATGTCATATAAATGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164387429 19:27786289-27786311 TTTACAGAATGTCATATACTTGG - Intergenic
1164817703 19:31217877-31217899 TTTCCAGAATGTCACACAGTTGG + Intergenic
1164894323 19:31857976-31857998 TTTCCAAAATGTCATATAGTTGG - Intergenic
1165055243 19:33172152-33172174 TTTCCAGAATGTCATATGGTTGG + Intronic
1165127283 19:33607881-33607903 TCTCCAGAATGTCATAGAGTTGG - Intergenic
1165185102 19:34012480-34012502 TTTTCAAAATGTCATGTAGTTGG + Intergenic
1165284349 19:34827870-34827892 CTTTCCAAATGTCGTATAGTTGG - Intergenic
1166150735 19:40873344-40873366 TCTCCAGAATGTCATATAGTTGG + Intronic
1166179588 19:41098223-41098245 TTTCCAGAATGTCATATAGTTGG - Intergenic
1166289894 19:41856208-41856230 TTTCCAGAATGTCATATAGTTGG + Intergenic
1166290064 19:41857202-41857224 TTTCCAGAATGTCATATAGTTGG - Intergenic
1166396813 19:42447234-42447256 ATGACAGAATGTCATAAGGTTGG + Intergenic
1167127575 19:47561017-47561039 TTTCCAGAATGTGATATAGTTGG - Intergenic
1167977353 19:53240613-53240635 TTTTCAGAATGTCATATAGTTGG - Intronic
1168138935 19:54371865-54371887 TTTCCAGAATGTCACATAGTTGG + Intergenic
1168142021 19:54394544-54394566 TTTCCAGAATGTCATATTGTTGG + Intergenic
1168158999 19:54495998-54496020 CTTCCAGAATGTCACATAGTTGG - Intergenic
1168446327 19:56418276-56418298 CTTTAAAAATGTCTTGAAGTTGG + Intronic
1168518073 19:57025130-57025152 TTTCCAGAATGTCATGTAGTGGG + Intergenic
925032256 2:660110-660132 TTTCCAGAATGTCATAGAGTTGG - Intergenic
925253193 2:2459890-2459912 TTTCCAGAATGTCCTATAGTTGG - Intergenic
925435549 2:3834421-3834443 GTTCCAGAATGTCATAGAGTTGG + Intronic
925502463 2:4521533-4521555 TTTCCAGAATGTCACATAGTTGG - Intergenic
925637460 2:5953877-5953899 TTTCCAGAATGTCACATAGTTGG - Intergenic
925643312 2:6008292-6008314 CTTTCAGAATGTCAGAATATGGG - Intergenic
925739230 2:6990905-6990927 TTTCCAGAATGTCCTAGAGTTGG + Intronic
925774085 2:7316189-7316211 TTTCCAGAATGTCATGTAGTTGG - Intergenic
926040861 2:9671937-9671959 TTTCCAGAATGTCATATAGTTGG + Intergenic
926470968 2:13257509-13257531 CTTACAGAATGCCATATAGTTGG + Intergenic
926486450 2:13466170-13466192 TTTCCAGAATGTCATATAATTGG - Intergenic
926630573 2:15132347-15132369 TTTCCAGAATGTCATATAGTTGG - Intergenic
926709481 2:15866740-15866762 TTTGCAGAATGACATATAGTTGG - Intergenic
926858935 2:17287429-17287451 TTTCCAGAATGTCATACAGCTGG + Intergenic
926877761 2:17502537-17502559 TTTCCAGAATGTCATATAGTTGG - Intergenic
926900301 2:17743809-17743831 TTTTCAGAACGTCATATAGTTGG + Intronic
926947682 2:18206013-18206035 TTTCCAGAATGTCATACGGTTGG + Intronic
927535122 2:23850576-23850598 TTTCCAGAATGTCATATAGTTGG - Intronic
927574184 2:24187650-24187672 TTTACAGAATGTCATATGGTTGG + Intronic
927764954 2:25798419-25798441 TTTCCAAAATGTCATATAGTTGG - Intronic
927941219 2:27104113-27104135 CTGTCAGAGTGCCACAAAGTGGG - Intronic
928020475 2:27700816-27700838 TTTCCAGAATGTCATATGGTTGG + Intergenic
928285134 2:29983633-29983655 TTTCTAGAATGTCATATAGTTGG + Intergenic
928719797 2:34106703-34106725 TTTTCAGAATGTCCTGAGGTTGG + Intergenic
928893092 2:36228656-36228678 TTTCCAGAATGTCAAATAGTTGG - Intergenic
929066984 2:37987462-37987484 TTCCCAGAATGTCATATAGTTGG - Intronic
929216841 2:39423688-39423710 TTTCCAGAATGTCATATAATTGG - Intronic
929266294 2:39922212-39922234 TTTTCAGAATGTGAAGAAGTAGG - Intergenic
929346702 2:40892996-40893018 TTTCCAGAATGTCATAGTGTTGG - Intergenic
929900260 2:45994508-45994530 TTTCCAGAATGTCCTATAGTTGG + Intronic
930042186 2:47134422-47134444 TTTCCAGAATGTCATAGAGGTGG + Intronic
930174362 2:48286520-48286542 TTTTCAGAATGTCATATAAATGG + Intergenic
930331675 2:49993333-49993355 CTTCTAGAATGTCATATGGTTGG - Intronic
930440911 2:51404090-51404112 TTTTCAAAATGTCATATAGTTGG + Intergenic
930450919 2:51536635-51536657 TTTCCAGAATGTCATATATTTGG + Intergenic
930496711 2:52154701-52154723 TTTTCAGAATGTCATACAGTCGG - Intergenic
930746502 2:54888584-54888606 TTTCCAGAATGTCATATAATTGG + Intronic
930891550 2:56394333-56394355 TTTTCAGAGTGTCAGATAGTTGG + Intergenic
931550159 2:63435263-63435285 CTTTCAGATTGACATAATTTTGG - Intronic
931569025 2:63648591-63648613 TTTTCAGAATGTCATATAAATGG + Intronic
931770660 2:65494463-65494485 TTTCTAGAATGTCATATAGTTGG + Intergenic
932058738 2:68473243-68473265 TTTTCAGAATGTCATAGAGTTGG + Intronic
932062048 2:68512267-68512289 CTTTCAGGATGTCATATAAATGG + Intronic
932215000 2:69960953-69960975 CTTTGAGAATGTGGTAAAGGTGG - Exonic
932470754 2:71953892-71953914 TTTCCAGAATGTTATATAGTTGG + Intergenic
932528822 2:72503414-72503436 TTTCCAGAATGGCATATAGTTGG + Intronic
932536434 2:72601937-72601959 ATTTCAGAATGTCACATAATTGG - Intronic
932786423 2:74608306-74608328 TTTCCAGAATGTCATATAGTTGG + Intronic
933084066 2:78032719-78032741 TTTTCAGAATATCATATAGTTGG - Intergenic
933206023 2:79509529-79509551 TCTCCAGAATGTCATAGAGTTGG - Intronic
933745011 2:85564206-85564228 TTTTCAGAATATCATACAGTTGG - Intronic
933865542 2:86513278-86513300 TTTCTAGAATGTCATATAGTTGG - Intronic
934739348 2:96708097-96708119 CTTTCACACCATCATAAAGTTGG - Intronic
934987349 2:98897176-98897198 CTTTGAGAATGTCACAAAAATGG + Intronic
935257616 2:101326212-101326234 TTTCAAGAATGTCATATAGTTGG - Intergenic
935459557 2:103313056-103313078 TTTTCAGAAGGTCATATAGTTGG + Intergenic
935519221 2:104083079-104083101 TTTTCAAAATGTCATACACTTGG + Intergenic
935616614 2:105090718-105090740 CTTCCAGAAAGTAATAAATTTGG - Intronic
935682421 2:105649476-105649498 TTTCCAGAATGTCATATAGTTGG - Intergenic
935875878 2:107506556-107506578 TTTTCAAAATGTCACATAGTTGG + Intergenic
936225686 2:110648315-110648337 TTTCCATAATGTCATATAGTTGG - Intronic
936459491 2:112702353-112702375 TTTTGAGAATGTCATGTAGTTGG + Intergenic
936664832 2:114582178-114582200 TTTCCAGAATGTCATATAGTTGG + Intronic
936772192 2:115927015-115927037 TTTCCAGAATGTCATATATTTGG + Intergenic
936774696 2:115958571-115958593 CTTCTAGAATGTCATATAGTTGG + Intergenic
936860219 2:117008064-117008086 TTTTCATAATGTCATATAGTTGG - Intergenic
936941936 2:117892398-117892420 TTTCCAGAATGTCATACAATTGG + Intergenic
937137576 2:119567337-119567359 TTTTCAGAATGTCATATAGTTGG + Intronic
937180707 2:119993709-119993731 TTTCTAGAATGTCATACAGTTGG - Intergenic
937481910 2:122270179-122270201 TTTGCAGAGTGTCATACAGTTGG + Intergenic
937695900 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG + Intronic
937806643 2:126152443-126152465 TTTCCAGAATGTCATTTAGTTGG + Intergenic
937850711 2:126632620-126632642 TTTCTAGAATGTCATACAGTTGG - Intergenic
937959258 2:127442219-127442241 TTTCCAGAATGTCATGTAGTTGG + Intronic
938005331 2:127785538-127785560 TTTCCAGAATGTCATACAGTTGG + Intronic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938970730 2:136429004-136429026 TTTCCAGAACGTCATATAGTTGG + Intergenic
939089972 2:137768650-137768672 TTTCCAGAATGTCATATAATTGG + Intergenic
939912266 2:147997170-147997192 ATTCCAGAATATCATATAGTTGG - Intronic
940200541 2:151145354-151145376 CTTACAGGATGTCATATGGTTGG - Intergenic
940248587 2:151647715-151647737 CTTTACGAATGTCAAAAACTTGG + Intronic
940313042 2:152298623-152298645 TTTCCAGAATGTTATATAGTTGG + Intergenic
940619179 2:156089254-156089276 TTCTCAGAATGTCATAGACTTGG + Intergenic
940687742 2:156875012-156875034 CTTTCAGAATGTAGAAAATTGGG + Intergenic
940949483 2:159656556-159656578 TTTGCAGAATGTCATATAGTTGG + Intergenic
940977765 2:159965365-159965387 TTTCCAGAATGTCATATAGTTGG + Intronic
941033909 2:160545413-160545435 TTTCCAGAATGTCATATAATTGG + Intergenic
941142560 2:161803585-161803607 TTTCCAGAATGTCATACAGTTGG + Intronic
941212483 2:162658395-162658417 CTTACAGTATGTCTTAAAGTTGG + Intronic
941224797 2:162834785-162834807 CTTTCAGAGTGTTTTCAAGTAGG - Intronic
941485678 2:166077985-166078007 TTTCCATAATGTCATATAGTTGG - Intronic
941570616 2:167165065-167165087 TTTCTAGAATGTCATATAGTTGG + Intronic
941597219 2:167492200-167492222 TTTCCAGAATGACATATAGTTGG + Intergenic
941603644 2:167567950-167567972 TTTCCAGAATGTCATATAATTGG + Intergenic
941706730 2:168666378-168666400 TTTTCAGAATGTCATATAATTGG + Intronic
941717396 2:168778551-168778573 TTTCCAGAATGTCATATAGTTGG - Intergenic
941888671 2:170555505-170555527 TTTTCAGAATGTCATATAGTTGG + Intronic
942111987 2:172691633-172691655 TTTGCAGAATGTCATATAGTTGG + Intergenic
942198908 2:173551426-173551448 TTTCCAGAATGTCATATAGTTGG - Intergenic
942332819 2:174845944-174845966 GTTTCAAAATGTGATAAAGCTGG - Intronic
942364518 2:175209441-175209463 TTTCCAGAATATCATACAGTTGG + Intergenic
942504529 2:176627684-176627706 TTTCCAGAATGTCATATAGTTGG - Intergenic
942542302 2:177027287-177027309 TCTTCAGAATGTCACATAGTTGG - Intergenic
942627280 2:177915413-177915435 TTTCCAGAATGTCACATAGTTGG + Intronic
942709429 2:178816264-178816286 TTTTCAGAATACCATATAGTTGG + Intronic
942895897 2:181053912-181053934 CCTCCAGAATGTCATATAGATGG + Intronic
942906917 2:181194142-181194164 TTTCCAGAATGTCACATAGTTGG - Intergenic
942957697 2:181793235-181793257 TTTCCAGAATGTCATATAATTGG - Intergenic
943031967 2:182696386-182696408 TTTTCAGAACGTCATGTAGTTGG - Intergenic
943156122 2:184179809-184179831 TTTCCAGAATGTCATATAATTGG + Intergenic
943234258 2:185297755-185297777 TTTTCAGATTGTCATATAGTTGG + Intergenic
943464573 2:188213204-188213226 TTTCCAGAATGTCATATAGTTGG + Intergenic
943710518 2:191089826-191089848 TTTCCATAATGTCATATAGTTGG - Intronic
943840139 2:192569984-192570006 TTTTCAGAATGTCACAAAGTTGG + Intergenic
943857298 2:192813691-192813713 TTTTCAGAATGTCATATAGTTGG + Intergenic
943932607 2:193873246-193873268 TTTCCAGAATGTCATTTAGTTGG + Intergenic
943944285 2:194039144-194039166 TTTCCAGAGTGTCATATAGTTGG - Intergenic
944161911 2:196671291-196671313 TTTCCAGAATGCCATATAGTTGG + Intronic
944276240 2:197841433-197841455 TTTTCAGAATGTCATATAGTTGG + Intronic
944379775 2:199094804-199094826 CTTCCAGAATATCATATAGTTGG - Intergenic
944483002 2:200176254-200176276 TTTCCGGAATGTCATATAGTTGG + Intergenic
944562173 2:200951087-200951109 TTTCCAGAATGTCATATAGTTGG + Intronic
944603859 2:201331628-201331650 TTTTCAGAATGTCATATAGTTGG - Intronic
944690899 2:202157677-202157699 CTTACCGAATGTCACACAGTTGG + Intronic
944730378 2:202510507-202510529 TTTCCAGAAAGTCATATAGTTGG - Intronic
944785351 2:203064660-203064682 CTTTAAAAATATCACAAAGTGGG + Intronic
945018752 2:205549560-205549582 ATTCCAGAGTGTCATATAGTTGG - Intronic
945166096 2:206948352-206948374 TTTTCAGAATGTAACATAGTTGG - Intronic
945393110 2:209288434-209288456 TTTTCAAAATGTCATATAATTGG - Intergenic
945472493 2:210242862-210242884 TTTCCAGAATGTCATGTAGTTGG + Intergenic
945527875 2:210911312-210911334 TTTTCAGAATGTCATATAATTGG - Intergenic
945534605 2:210999181-210999203 TCTTTAGAATGTCATATAGTTGG + Intergenic
945778020 2:214131730-214131752 TTTCCAGAATGTCACATAGTTGG - Intronic
945881686 2:215330866-215330888 TTTCCAGAATGTCAGATAGTTGG + Intronic
945958325 2:216106900-216106922 CTTTAAAAATGGGATAAAGTGGG + Intergenic
946011833 2:216571496-216571518 TTTGCAGAATGTCATCAAATTGG - Intronic
946661422 2:222004222-222004244 TCTTCAGAATGTCATATGGTTGG + Intergenic
946711655 2:222512697-222512719 TTTCTAGAATGTCATATAGTTGG + Intronic
946917447 2:224539725-224539747 TTTCCAGAATGTCATATAGTTGG - Intronic
946976228 2:225154686-225154708 TTTCCGGAATGTCATAGAGTTGG + Intergenic
947036360 2:225862267-225862289 TTTCCAGAATGTCATAAAAGTGG - Intergenic
947116295 2:226774861-226774883 TTTCCAGAATGTCATAAAATTGG - Intronic
947495209 2:230631057-230631079 TTTTCAGAATGTCATATAGTTGG - Intergenic
947570742 2:231232322-231232344 CTCTTAGAATGTGATAAATTTGG - Intronic
947798460 2:232909838-232909860 CTTTCAGAATGTCATAGAAATGG + Intronic
948078097 2:235182367-235182389 TTTCCAGAATGGCATAGAGTTGG + Intergenic
1168988845 20:2077115-2077137 TTTCCAGAATGTCATATAGTTGG - Intergenic
1169398930 20:5262969-5262991 TTTCCAGAATGTCATATAATTGG - Intergenic
1169529526 20:6469535-6469557 TTTTCAGAATGTAATACTGTAGG - Intergenic
1170247157 20:14233830-14233852 TTTCCATAATGTCATATAGTTGG - Intronic
1170365138 20:15589742-15589764 TTTCCAGAATGTCATATAGTTGG + Intronic
1170378016 20:15723506-15723528 TTCTAAGAATGTCATATAGTTGG + Intronic
1170400201 20:15974443-15974465 TTTCCAGAATGTCATATAATTGG - Intronic
1170417016 20:16155389-16155411 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1170636345 20:18108108-18108130 TTTCCAGAATGTCATATAGTTGG + Intergenic
1170651755 20:18249155-18249177 TTTCCAGAATGTCACATAGTTGG + Intergenic
1170689359 20:18598923-18598945 TTTTTAGAATGTCATATATTTGG + Intronic
1170851831 20:20011813-20011835 CTTTCAGAATGTCATATAAATGG + Intergenic
1170867551 20:20173004-20173026 TTTACAGAATGTCACAAAGTTGG + Intronic
1171140883 20:22741497-22741519 TTTTCAGAATGTCATGTAGTTGG - Intergenic
1171319569 20:24229485-24229507 TTTCCAGAATGTCACATAGTTGG - Intergenic
1171340900 20:24427974-24427996 TTTCCAGAATGTCATATATTTGG - Intergenic
1171468045 20:25346246-25346268 TTTACAGAATGTCATATAGTTGG - Intronic
1172322364 20:34005816-34005838 TTTGCAGAACGTCATACAGTTGG + Intronic
1172576489 20:36012892-36012914 TTTCCAGAATGTCATAGAATTGG - Intronic
1172927964 20:38557582-38557604 TTTTCAGAATGTCATATAGTTGG + Intronic
1173175400 20:40761046-40761068 TTTCCAGAATGTCACAGAGTTGG + Intergenic
1173194572 20:40903799-40903821 TTTCCAGAATGTCATATAGTTGG - Intergenic
1173234384 20:41231086-41231108 TTTTCAGAATGTCATATAGTTGG + Intronic
1173770240 20:45650002-45650024 CTTTCAGAATGTGAAAAGTTAGG - Intronic
1174209169 20:48863532-48863554 TATCCAGAATGTCATATAGTTGG + Intergenic
1175237183 20:57522944-57522966 CTTTCAAAATGTCAGGAAATGGG - Intronic
1175454262 20:59098568-59098590 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1175464905 20:59184091-59184113 TTTCCAGAAGGTCATACAGTTGG + Intergenic
1175496232 20:59416295-59416317 TTTCCAGAATGTCATCTAGTTGG + Intergenic
1175580870 20:60098096-60098118 TTTTCAAAATGTCATACAGTTGG + Intergenic
1175614254 20:60379713-60379735 ATTTTAGAATGTCATATGGTTGG - Intergenic
1175659447 20:60799686-60799708 TTTCCAGAATGTCATATAATTGG - Intergenic
1175789034 20:61730373-61730395 TTTTCAGAATGTCATGGAGTTGG + Intronic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1177005209 21:15664074-15664096 CTTTCAGAAAGCCAGCAAGTTGG + Intergenic
1177092620 21:16788085-16788107 CTTCCAGAATGCCACAAAATGGG + Intergenic
1177221521 21:18199681-18199703 ATTACATAATGTCATATAGTTGG + Intronic
1177283085 21:19010568-19010590 TTTCTAGAATGTCATATAGTTGG - Intergenic
1177407304 21:20686434-20686456 TTTCCAGAATGTCATATACTTGG - Intergenic
1177469125 21:21533345-21533367 TTTCCGGAATGTCATATAGTTGG + Intronic
1177476466 21:21630516-21630538 TTTCCAGAGTGTCATATAGTTGG - Intergenic
1177638857 21:23820420-23820442 CTTCCAGAATGTCATATAATTGG - Intergenic
1177673615 21:24267586-24267608 TTTCCAGAATGTGATATAGTTGG + Intergenic
1177826710 21:26092444-26092466 TTTCCAGAATGTCATATAGTGGG - Intronic
1177846863 21:26299762-26299784 TTTCTAGAATGTCATATAGTTGG - Intergenic
1178031406 21:28530428-28530450 TTTCCAAAATGTCATATAGTTGG + Intergenic
1178115929 21:29416434-29416456 TTTTCAGAATGTCATATGGTTGG + Intronic
1178421827 21:32449434-32449456 TATCCAGAATGTCATATAGTTGG + Intronic
1178594944 21:33944944-33944966 TTTTCAAAATATCATATAGTTGG - Intergenic
1178628911 21:34242508-34242530 TTTCCAGAATGTCATATAGTTGG - Intergenic
1178636953 21:34312622-34312644 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1178770914 21:35503194-35503216 TTTCCAGAGTGTCATACAGTTGG + Intronic
1178967306 21:37133419-37133441 TTTTGAGAATTTCTTAAAGTTGG + Intronic
1178988716 21:37333107-37333129 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1179038392 21:37780235-37780257 TTTGCAGAATGTCATATAGTTGG - Intronic
1179113218 21:38465327-38465349 TTTCCAGAATGTCATATAATTGG - Intronic
1179314463 21:40229575-40229597 TTTTCAGAATGTCATAAAAATGG + Intronic
1179349861 21:40598169-40598191 TTTCCAGAATGTCATATGGTTGG + Intronic
1179503964 21:41827791-41827813 CTTTCAATATGACAGAAAGTGGG - Intronic
1179636690 21:42715968-42715990 TTTCCAGAATGTCACATAGTTGG + Intronic
1180010417 21:45046355-45046377 TTTCCAGAATATCATATAGTTGG - Intergenic
1180034571 21:45237928-45237950 TTTTCAAAATGTCATATAGTTGG - Intergenic
1180116742 21:45711992-45712014 TTTCCAGAATGTCATATAGTTGG + Intronic
1180129575 21:45818932-45818954 TTTCCAGAATGTCATATAGTTGG - Intronic
1180507489 22:16027620-16027642 TTTCCAGGATGTTATAAAGTTGG - Intergenic
1180760062 22:18195115-18195137 TTTCCAGAATGTCATATAGTTGG - Intergenic
1180770374 22:18379414-18379436 TTTCCAGAATGTCATATAGTTGG - Intergenic
1180775606 22:18429585-18429607 TTTCCAGAATGTCATATAGTTGG + Intergenic
1180808679 22:18740622-18740644 TTTCCAGAATGTCATATAGTTGG + Intergenic
1180828315 22:18882367-18882389 TTTCCAGAATGTCATATAGTTGG - Intergenic
1180907815 22:19427503-19427525 TTTTCAGAATGACACAAGGTAGG + Intronic
1180941861 22:19664895-19664917 TTTCCAGACTGTCATAGAGTTGG - Intergenic
1181071606 22:20345596-20345618 TTTCCAGAATGTCATATAGTTGG + Intergenic
1181194676 22:21174538-21174560 TTTCCAGAATGTCATATAGTTGG + Intergenic
1181214768 22:21318232-21318254 TTTCCAGAATGTCATATAGTTGG - Intergenic
1181807213 22:25382425-25382447 TTTCCAGAATGTCATAGAGTTGG - Intronic
1182037654 22:27211947-27211969 CTTTAAGAATGTCATATAAATGG - Intergenic
1182056560 22:27360178-27360200 CTTACAGACTGTCATATATTTGG + Intergenic
1182277882 22:29201906-29201928 CTGTCAGAAAATCATAAATTAGG - Intergenic
1182315423 22:29443707-29443729 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1182673855 22:32021673-32021695 TTTCCAGAATGTCATATAATTGG - Intergenic
1182694658 22:32189178-32189200 TTTCTAGAATGTCATATAGTTGG + Intergenic
1182716687 22:32362272-32362294 TTTCCAGAATGTCATACAGTTGG - Intronic
1182824178 22:33248772-33248794 TTTCCAGAATGCCATATAGTTGG + Intronic
1182983062 22:34690456-34690478 TTTTCAGGATGTTATATAGTTGG - Intergenic
1183753520 22:39736973-39736995 CTTTCAGCACATCATAAAGGTGG - Intergenic
1184634027 22:45811946-45811968 CTTTTAGAATGTGATAGACTAGG - Intronic
1185169427 22:49284054-49284076 TTTCCAGAATGTCATATGGTTGG - Intergenic
1185232439 22:49690916-49690938 TTTTCAGAATGTCATACAAATGG - Intergenic
1185404435 22:50639441-50639463 CTTTCTGAAAGTCTCAAAGTGGG + Intergenic
1203232207 22_KI270731v1_random:120598-120620 TTTCCAGAATGTCATATAGTTGG - Intergenic
1203278412 22_KI270734v1_random:108372-108394 TTTCCAGAATGTCATATAGTTGG - Intergenic
949146852 3:711096-711118 TTTCCAGAATATCATATAGTTGG + Intergenic
949286951 3:2417907-2417929 TTTCCAGAATGTCATATAGTTGG - Intronic
949358674 3:3208668-3208690 TTTGCAGAATGTCATATAGTTGG - Intergenic
949409809 3:3751304-3751326 TTTCCAGAATGTCATAAAGTTGG + Intronic
949428777 3:3949901-3949923 TTTCCAGAATGTCATACAGTTGG - Intronic
949463529 3:4319925-4319947 TTTCCAGAGTGTCATATAGTTGG - Intronic
949703586 3:6788160-6788182 TTTCCTGAATGTCATATAGTTGG + Intronic
949723762 3:7020278-7020300 TTTCCAGAATGTCACATAGTTGG - Intronic
950402678 3:12781988-12782010 TTTATAGAATGTCATATAGTTGG - Intergenic
950424478 3:12917462-12917484 TTTCCAGAATGTCATAGAGTTGG + Intronic
950635278 3:14309986-14310008 TTTCCAGAATGTCATACAGTTGG - Intergenic
950823249 3:15785962-15785984 TTTCCAAAATGTCATATAGTTGG - Intronic
950995167 3:17488199-17488221 TTTCCACAATGTCATATAGTTGG + Intronic
950995939 3:17495845-17495867 ATTTCTGAACATCATAAAGTAGG - Intronic
951055239 3:18139666-18139688 CTTTCCCAATGTCACACAGTTGG - Intronic
951097600 3:18649986-18650008 CTTTCAGGTTTACATAAAGTGGG + Intergenic
951286732 3:20822328-20822350 CTTTAAAAATGGCATAAAGAAGG + Intergenic
951344567 3:21531669-21531691 TTTCCAGAATGTCATGAAGTTGG - Intronic
951416888 3:22435114-22435136 TTTTCAGAATGTCATATAGTGGG - Intergenic
951479973 3:23149991-23150013 TTTTCAGAATGTCATATAGTTGG - Intergenic
951737727 3:25886365-25886387 ATTTCAACATTTCATAAAGTAGG + Intergenic
951829657 3:26911957-26911979 TTTCCAGAATGTCATATTGTTGG - Intergenic
951890948 3:27567504-27567526 TTTCCAAAATGTCATATAGTTGG + Intergenic
952160719 3:30690651-30690673 TTTCCAGAGTGTCATATAGTTGG - Intronic
952433003 3:33243967-33243989 TTTTCAGAATGTCATATAAATGG - Intergenic
952563859 3:34631572-34631594 TTTCCAGAATGTCATATAGTTGG + Intergenic
952636036 3:35533134-35533156 TTTCCAGAATGTCATACAGTTGG - Intergenic
953189582 3:40671275-40671297 TTTCCAAAATGTCATATAGTTGG - Intergenic
953192689 3:40702378-40702400 TTTCCAGAATGTCATATAGCTGG + Intergenic
953894886 3:46789469-46789491 TTTCCAGAATGTCATATGGTAGG - Intronic
954058499 3:48048989-48049011 CTTTGAGAATGTCATATAAATGG + Intronic
954203818 3:49042475-49042497 TTTCCAGAATGTCATATAGTTGG - Intronic
955081660 3:55663418-55663440 CTTACAGATTGCCAGAAAGTTGG - Intronic
955203167 3:56870393-56870415 TTTTCAGAATGCCATATAGTTGG - Intronic
955262989 3:57413210-57413232 TTTTCAGAATGTCATATAGTTGG - Intronic
955692082 3:61600850-61600872 TTTTTAAAATGTCTTAAAGTTGG + Intronic
955949217 3:64225268-64225290 CCTTCAGATTGTCATGAAGAAGG - Exonic
956035423 3:65085411-65085433 TTTCCAGAATGTCATATAGTTGG + Intergenic
956053421 3:65273703-65273725 TTTCCAGAATGTCATATACTTGG - Intergenic
956170447 3:66429494-66429516 TTCTCAGAATGTCATACATTTGG - Intronic
956548361 3:70432882-70432904 TTTTCAGTATGTCATAAAGTTGG + Intergenic
956771388 3:72529003-72529025 TTTCCAGAATGTCATATGGTTGG - Intergenic
956954665 3:74322915-74322937 TTTCCAGAATGTCATATTGTTGG - Intronic
956994389 3:74807420-74807442 CTTTCAAAATGTCAAACAGGAGG + Intergenic
957049453 3:75400118-75400140 TATCCAGAATGTCATATAGTTGG - Intergenic
957374892 3:79343067-79343089 TTTTCGGAATGTCATATTGTTGG + Intronic
957485412 3:80855390-80855412 TTTCCAGAATGTCATATAGTTGG + Intergenic
957628230 3:82682543-82682565 TTTTCAGAATGTCATCTAGTTGG + Intergenic
957670750 3:83299379-83299401 TTTCCAGAATGTCATATTGTTGG - Intergenic
957736234 3:84207053-84207075 TTTTCAGAGTGTCATATATTTGG - Intergenic
957794922 3:84991920-84991942 TTTCCAGAATATCATATAGTTGG - Intronic
957825491 3:85437068-85437090 TTTCCAGAATGTCATGCAGTTGG + Intronic
957941618 3:87013024-87013046 TTTTCAGAATGTCATGAAGTTGG - Intergenic
958001810 3:87760653-87760675 TTTCCAGAATGTCATATAGTTGG - Intergenic
958017160 3:87951889-87951911 TTTCCAGAATGTCATGTAGTTGG + Intergenic
958627787 3:96648261-96648283 TTTTCAGAATGTCAGATAATTGG - Intergenic
958900825 3:99884577-99884599 CCTACAGAATCCCATAAAGTGGG - Intronic
958933558 3:100233352-100233374 TTTCCAGAATGTCACATAGTTGG - Intergenic
959257006 3:104028170-104028192 TTTTTAGAATTTCATATAGTTGG + Intergenic
959369693 3:105507488-105507510 TTTCCAGAATGGCATATAGTTGG + Intronic
959468355 3:106718539-106718561 CTTAGAGAATGTTAGAAAGTAGG - Intergenic
959607171 3:108254143-108254165 CTTCCAGAGTGTCATATAATTGG + Intergenic
959933541 3:112007462-112007484 TTTCTAGTATGTCATAAAGTAGG + Intronic
959980019 3:112505533-112505555 TTCCCAGAATGTCATATAGTTGG + Intergenic
960035730 3:113101413-113101435 TTTCCAGAATGTCATATGGTTGG + Intergenic
960213664 3:115003078-115003100 TTTCCAGAATGTCATATAGTTGG - Intronic
960220647 3:115104637-115104659 TTTTCAGAATGTCATATAGTTGG - Intronic
960341789 3:116483895-116483917 TTTTCAGGATGTTATATAGTTGG - Intronic
960490185 3:118307937-118307959 TTTCCAGAATGTTATAAAATTGG - Intergenic
960634566 3:119770313-119770335 CTTTTAGGATGTCATACAGAAGG - Intergenic
960659893 3:120046002-120046024 TTTTCAGAATGTCCTATAGTTGG - Intronic
960761341 3:121076486-121076508 CTTACAGTAGGTCTTAAAGTAGG + Intronic
960834130 3:121886991-121887013 TTTCCAGAATGTCATGTAGTTGG + Intergenic
960893824 3:122480088-122480110 TTTCCAGAATGTCATATAGTTGG - Intronic
960895807 3:122503870-122503892 CTTCCAGAATGTCATATAATTGG - Intronic
961029936 3:123592985-123593007 TTTCCAGAATGTCATATAGTTGG + Intergenic
961187106 3:124925242-124925264 TTTCCAGAAAGTCATATAGTTGG - Intronic
961679499 3:128589621-128589643 TTTCCAGAATGTCATAGAATTGG + Intergenic
961691358 3:128672162-128672184 TTTCCAGAATGTCATATAGTTGG + Intronic
962090625 3:132240722-132240744 CATTCAGAAAGTGAGAAAGTAGG - Intronic
962568221 3:136685707-136685729 TTTCCAGAATGTCATATAGTTGG - Intronic
962590579 3:136885860-136885882 TTTTTAGAATGTTATAAAGTTGG + Intronic
962621442 3:137183928-137183950 TTTCCAGAATGTCATATAGTTGG + Intergenic
962658746 3:137578923-137578945 TTTCCAGAATGTCATATAGTTGG - Intergenic
962705945 3:138044637-138044659 TTTCCAGAATGTCATATAGGTGG + Intergenic
962718112 3:138145791-138145813 TTTCCAGAATGTCATATAGTTGG - Intergenic
962822464 3:139064578-139064600 TTTCTAGAATGTCATATAGTTGG + Intronic
963023471 3:140896266-140896288 TTTTCTGAATGTCTTTAAGTTGG + Intergenic
963165056 3:142192936-142192958 TTTCCAGAATATCATATAGTTGG - Intronic
963424482 3:145108829-145108851 TTTTCAGAATGTCTTATAGCTGG + Intergenic
963465243 3:145671596-145671618 TTTACAGAATGTCATATAGTTGG - Intergenic
963698436 3:148592636-148592658 TTTCCAGAATGTTATATAGTTGG - Intergenic
964234403 3:154507848-154507870 TTTCCAGAATGCCATATAGTTGG + Intergenic
964460996 3:156928070-156928092 TTTCCAGAATGTCATATAGTTGG - Intronic
964536989 3:157733445-157733467 TTTCCAGAATGTCATATAGTTGG - Intergenic
964739330 3:159949165-159949187 TTGCCAGAATGTCATAGAGTTGG - Intergenic
964800182 3:160547781-160547803 TTTAAAGAATGTCATATAGTTGG + Intronic
964818549 3:160743795-160743817 TTTCCAGAATGTCATATAGTTGG + Intergenic
964865729 3:161258299-161258321 TTTTCAGAATGTCGTATAATTGG + Intergenic
964909429 3:161760494-161760516 CTTTCTCCATGTCATAAATTAGG - Intergenic
964951343 3:162298040-162298062 GTTTCAGAATTACAAAAAGTTGG + Intergenic
965152023 3:164989852-164989874 TTTCCAGAATGTCATATAGTTGG - Intronic
965231116 3:166054076-166054098 TTTTGAGAATGTCATATATTTGG + Intergenic
965283594 3:166786368-166786390 TTTTAAGAATGTCATATAGTTGG - Intergenic
965637462 3:170798210-170798232 TTTTCAGAATGTAATACAGCTGG - Intronic
965740087 3:171865175-171865197 CTTTTAGAATGTAACAATGTTGG + Intronic
966194033 3:177296227-177296249 TTCTCAGAATGTCATATAGTTGG + Intergenic
966295562 3:178417556-178417578 TTTCCAGAATGTCATATAGTTGG + Intergenic
966511464 3:180768175-180768197 TTTCCAGAATGTCATATAATTGG - Intronic
966545988 3:181149054-181149076 TTTTCAGTATGTCATATAGTTGG - Intergenic
966636964 3:182145994-182146016 TTTCCAGAATGTTATATAGTTGG - Intergenic
966965473 3:184987451-184987473 CTTCCAGAATGTCATATAGTTGG + Intronic
967151627 3:186656068-186656090 TTTTCCAAATGTCATATAGTTGG - Intergenic
967363663 3:188661059-188661081 TTATCAGAATGTCTTATAGTTGG + Intronic
967456782 3:189696269-189696291 TTTACAGAATGTCATATACTTGG + Intronic
967808970 3:193739353-193739375 TTTCCAGAATGTCATATGGTGGG + Intergenic
968111275 3:196048895-196048917 TTTCCAGACTGTCATACAGTTGG - Intronic
968227319 3:196981613-196981635 TTTCCAGAATGTCATATAGTTGG - Intergenic
968674094 4:1867976-1867998 TTTCCAGAATGTCATGGAGTTGG + Intergenic
968716696 4:2165347-2165369 TTTCCAGAATGTTATAAAATTGG - Intronic
969140239 4:5063720-5063742 CTTTCAGCATGTCTTAATCTGGG + Intronic
969709514 4:8834715-8834737 CTTTCAGGATGACATAAAGGAGG + Intergenic
969822143 4:9728896-9728918 TATCCAGAATGTCATATAGTTGG + Intergenic
970119406 4:12735858-12735880 TTTCCAGAATGTCATATAGTTGG + Intergenic
970226608 4:13864860-13864882 TTTTCAGAATGTCATATAGTTGG + Intergenic
970359068 4:15289545-15289567 TTTCCAGAATATCATATAGTTGG - Intergenic
970545103 4:17121368-17121390 TTTCCAGAATGTCATATAGTTGG - Intergenic
970632591 4:17967179-17967201 TTTTTAGAATGTCATATAGTTGG - Intronic
970745167 4:19285578-19285600 CTTTCAGAATGATATTAAATTGG + Intergenic
970924019 4:21429199-21429221 TTTCAAGAATGTCATATAGTTGG + Intronic
971189250 4:24411736-24411758 TTTCCAGAATGTCATATAGTTGG + Intergenic
971433256 4:26591117-26591139 TTTTAAGAATGTCATATAGTTGG + Intronic
971630549 4:28987630-28987652 TTTACAAAGTGTCATAAAGTTGG + Intergenic
971904696 4:32711284-32711306 TTTCCAGAATGTCATATAGTTGG + Intergenic
972264363 4:37444782-37444804 CTTTTAGAGTGTGATAAAGATGG + Exonic
972406331 4:38750204-38750226 TTTTCAGAATGTCATATAGTTGG + Intergenic
972886571 4:43498597-43498619 TTTCCACAATGTCATATAGTTGG + Intergenic
972916459 4:43886548-43886570 TTTTCAGAATATCATATAGCTGG + Intergenic
972936425 4:44141532-44141554 TTTCCAGAATGTCAGATAGTTGG + Intergenic
973004683 4:44992524-44992546 CTTACAGACTGGCATAAATTTGG - Intergenic
973134978 4:46695899-46695921 TTTCCAGAATGTTATATAGTTGG + Intergenic
973184788 4:47313119-47313141 CTTTCAAAATGTCAATAAATTGG + Intronic
973235437 4:47897801-47897823 TTTCCAGAATGTCATATAGTTGG + Intronic
973331826 4:48917036-48917058 TTTCCAGAATGTCATATAGTTGG + Intergenic
973561754 4:52144027-52144049 TGTTCAGCATGGCATAAAGTGGG + Intergenic
973635287 4:52856636-52856658 TTTCCAGAATGTCATATACTTGG + Intergenic
973904334 4:55511825-55511847 TTTCCAGAATGTCATGAAGTTGG + Intronic
974195490 4:58569380-58569402 CTTGCAGAATGGCCTATAGTAGG + Intergenic
974854979 4:67450533-67450555 TTTACAGAATGTCATATAATAGG - Intergenic
975124534 4:70766979-70767001 TTTCCAGAATGTCATGTAGTGGG + Intronic
975182153 4:71358384-71358406 CTTTCAGAATAACATAAAACCGG + Intronic
975263787 4:72337074-72337096 CTTTCAGTTGGTCATGAAGTTGG + Intronic
975958471 4:79871659-79871681 TTTTCAGAATGTCATACAGTTGG - Intergenic
976133342 4:81908397-81908419 GTTCCAGAATGTCACATAGTTGG - Intronic
976346383 4:84007147-84007169 TTTTCAGAACGTCATATAATTGG + Intergenic
976470445 4:85422114-85422136 TTTTCAAAATGTCATATAGTTGG + Intergenic
976650453 4:87428638-87428660 CTTCAAGAATGCCATATAGTTGG - Intronic
977124854 4:93152346-93152368 TTTTCAGATTGTTTTAAAGTAGG - Intronic
977374751 4:96187774-96187796 TATTTAGAATGTCATATAGTTGG + Intergenic
977823111 4:101499573-101499595 TTTCCAGAATGTCATATACTTGG - Intronic
977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG + Intronic
978129521 4:105178363-105178385 TTTCCGGAATGTCATATAGTTGG - Intronic
978135437 4:105252245-105252267 ATTCCAGAATGTCATATAGTTGG + Intronic
978154940 4:105478744-105478766 TTTCCAGAATGTCATACAGCTGG - Intergenic
978242063 4:106527243-106527265 TTTCCTGAATGTCATATAGTTGG + Intergenic
978243637 4:106547122-106547144 TTTTCAGAATGTCATATGTTTGG - Intergenic
978424649 4:108569520-108569542 TTTCCAGAATGTCATATAGTTGG - Intergenic
978426347 4:108586875-108586897 TTTACAGAATCTTATAAAGTGGG + Intergenic
978475331 4:109122047-109122069 TTTTCAGAATATCATATAGCTGG - Intronic
978670506 4:111243245-111243267 TTTTCCAAATGTCATATAGTTGG - Intergenic
978686138 4:111445743-111445765 TTTCCAGAATGTCATGAAGTTGG - Intergenic
979067867 4:116161200-116161222 TATCCAGAATGTCATATAGTTGG + Intergenic
979102780 4:116643678-116643700 TTTCCAGAATTTCATATAGTTGG - Intergenic
979529666 4:121756265-121756287 TTTTCAGAATGTCATATAATTGG - Intergenic
979943561 4:126794923-126794945 TTTCAAGAATGTCATATAGTTGG - Intergenic
979991364 4:127379365-127379387 TTTCCAGAATGTCATATAATTGG + Intergenic
979996893 4:127442129-127442151 TTTCCTGAATGTCATATAGTTGG - Intergenic
980278695 4:130689386-130689408 TTTCCAGAATGTCATATTGTTGG + Intergenic
980327185 4:131361914-131361936 TTTGCAGAATGTTATATAGTTGG - Intergenic
980540268 4:134184462-134184484 TTTCCAGAATGTCATATAGTTGG + Intergenic
980652635 4:135739318-135739340 CTTTTAAAATTTCATAAAATAGG - Intergenic
980690214 4:136286523-136286545 TTTTAAGACTGTCATATAGTTGG - Intergenic
980776304 4:137440940-137440962 TTTTCAAAATGTCATATAGTTGG - Intergenic
980793467 4:137650381-137650403 TTTCCAGAATGTCATTTAGTTGG - Intergenic
981185455 4:141796428-141796450 TTTCCAGAATGTCATATACTTGG + Intergenic
981263877 4:142757501-142757523 TTTCCAGAATGTCATGTAGTTGG + Intronic
981438235 4:144751336-144751358 TTTCCTGAATGTCATATAGTTGG + Intergenic
981486424 4:145291395-145291417 CTTCCAGAATGTCCTAGAGTTGG + Intergenic
981534002 4:145780642-145780664 CTATGATAATGTCATAAAATAGG + Intronic
981802519 4:148674751-148674773 TTTTTAGAAAGTCATATAGTTGG + Intergenic
981877142 4:149560196-149560218 CTTTGAAAATTTGATAAAGTAGG - Intergenic
981943069 4:150307196-150307218 TTTTCAGAATGTCATATAAATGG - Intronic
982058585 4:151579019-151579041 TTTCCAGAATGTCGTATAGTTGG - Intronic
982133622 4:152251834-152251856 TTTTCAGAATACCATATAGTTGG + Intergenic
982146585 4:152401461-152401483 TTTCCAGAATGTCATATAGTTGG - Intronic
982211900 4:153044536-153044558 TTTCCAGAATGTCATATAGTTGG - Intergenic
982253449 4:153430459-153430481 CTTTGTGAATGGTATAAAGTAGG - Intergenic
982429213 4:155303419-155303441 TTTCAAGAATGTCATATAGTTGG - Intergenic
982839206 4:160160710-160160732 TTTCCAGAATGTCATATAGTTGG - Intergenic
982892912 4:160878503-160878525 TATCCAGAATGTCATATAGTTGG - Intergenic
983074813 4:163313049-163313071 TCTTCACAATGTCATATAGTTGG + Intergenic
983378863 4:166966060-166966082 TTTCCAGAATGTCATATAGTTGG + Intronic
983386935 4:167076073-167076095 TTTCCAGAATGCCATACAGTTGG - Intronic
983611183 4:169647048-169647070 CTATCTGAATGTCATGATGTAGG - Intronic
983926325 4:173406696-173406718 CTTCTAGAATGTCATATAATTGG + Intergenic
984257370 4:177404726-177404748 TTTTCAGATTGTCAGACAGTAGG - Intergenic
984360285 4:178721177-178721199 TTTCCAGAATGTCATATAATTGG + Intergenic
984636515 4:182116256-182116278 TTTCCAGAATGTCATATAGTTGG + Intergenic
984703080 4:182831191-182831213 TTTCCAGAATGTCACATAGTTGG - Intergenic
985759548 5:1738260-1738282 TTTTCAGAATGTCCTAGAGTTGG + Intergenic
985962769 5:3315336-3315358 TTTTCAGAATGTCATGTAGTTGG + Intergenic
986166318 5:5274425-5274447 TTTCCAGAATGTCATATAGTTGG + Intronic
986272764 5:6248469-6248491 TTCCCAGAATGTCATATAGTTGG + Intergenic
986325884 5:6673884-6673906 TTTTCAGAATGTTATACAGTTGG - Intergenic
986398434 5:7354545-7354567 TTTTCAGAATGTCACATATTTGG + Intergenic
986563526 5:9087030-9087052 CTTTCAGATTGTCACACAGATGG - Intronic
986669912 5:10133561-10133583 TTTCCAGAATGTCATATATTTGG + Intergenic
986973525 5:13367220-13367242 TTTTCAGAATGTCATAGAGTTGG - Intergenic
987315940 5:16723877-16723899 CTTTCTGGATGTCATATAATTGG - Intronic
987420698 5:17717020-17717042 TTTCCAGAATGTCATATAGTTGG - Intergenic
987450644 5:18079548-18079570 TTTTTAGAATGTCATATACTTGG + Intergenic
987463685 5:18246800-18246822 TTTTCAGAATGTCATGTAGTTGG + Intergenic
987556286 5:19455369-19455391 TTTCCAGAATGTCATATAATTGG - Intergenic
987637955 5:20569945-20569967 CTCTCAGAATGTCATGTAGTTGG - Intronic
987666242 5:20944739-20944761 TTTTGAGAATGTCATATGGTTGG + Intergenic
988001465 5:25354882-25354904 TTTTCAAAATGTCATATACTTGG - Intergenic
988150129 5:27366110-27366132 TTTTCAGAATGTTACAGAGTTGG - Intergenic
988517949 5:31920836-31920858 TTTCCAGAATGTCATATAGTTGG + Intronic
988756434 5:34257326-34257348 TTTTGAGAATGTCATATGGTTGG - Intergenic
988937203 5:36096319-36096341 TTTCCAGAATGTCATATAGTTGG + Intergenic
988951954 5:36271830-36271852 CTTACACAGTGTTATAAAGTAGG + Intronic
989021990 5:37018600-37018622 CTTTCTGTATTTCTTAAAGTGGG + Intronic
989277367 5:39604964-39604986 TTTCCAGAATGTCGTATAGTTGG + Intergenic
989307731 5:39977048-39977070 ATTTCAGTATTTCACAAAGTAGG + Intergenic
989381644 5:40814693-40814715 TTTTCAGAATGTCATATAATTGG + Intergenic
989436986 5:41425698-41425720 TTTTTAGAATGTCACATAGTTGG + Intronic
989804857 5:45590700-45590722 TTTCCAGAATGTCATATAGTTGG + Intronic
990094555 5:52095618-52095640 TTTCCAGAATGTTATATAGTTGG + Intergenic
990216271 5:53535896-53535918 TTGCCAGAATGTCATATAGTTGG - Intergenic
990372489 5:55134827-55134849 TTTCCAGAATGTCATATAGTTGG - Intronic
990528605 5:56652417-56652439 TTTCCAGAATGTCAAATAGTTGG - Intergenic
990555211 5:56927012-56927034 ATTTCAGAATGTCATATAGTTGG - Intronic
990555280 5:56927935-56927957 TTTTCAGAATATCATATATTTGG + Intronic
990808494 5:59694992-59695014 CTTTCAAATTGTATTAAAGTCGG + Intronic
990971623 5:61513191-61513213 TTTCCAGAATGTCATATAGTTGG + Intronic
991094886 5:62729261-62729283 GTTTCAGAATCAGATAAAGTTGG - Intergenic
991405433 5:66296548-66296570 TTTCCAGAATGGCATATAGTTGG + Intergenic
991647059 5:68810875-68810897 CTTCCAGAATGTCATATAAAAGG + Intergenic
992095004 5:73354751-73354773 TTTTCAGAATGTCATCTACTTGG - Intergenic
992134687 5:73732284-73732306 TTTCCAGAATGTCATAGAGTTGG + Intronic
992180314 5:74189888-74189910 TTTCCAGAATGTCATAGAGTTGG + Intergenic
992456267 5:76918911-76918933 TTTTCATAATGTCATATAATTGG + Intronic
992533841 5:77678427-77678449 TTTTCAGAATGCCATATAATTGG - Intergenic
992932980 5:81669935-81669957 TTTCCAGTATGTCATAAAGTTGG - Intronic
993195285 5:84734102-84734124 CATTCAGAATGTCATACATTTGG + Intergenic
993428711 5:87803360-87803382 ATTACAGAATGTCACAAATTTGG + Intergenic
993975845 5:94479315-94479337 TTTTCATAATGTCATATAGTTGG + Intronic
994387093 5:99145573-99145595 TTTCCAGAATGTCATATAGTTGG - Intergenic
994593332 5:101800089-101800111 TTTCCAGAATGTCATATAGTTGG + Intergenic
994717650 5:103341721-103341743 CTTCCAGATTGTCATGTAGTTGG + Intergenic
994907769 5:105863011-105863033 CTTTCACAACTTCATAAGGTAGG - Intergenic
994976200 5:106810294-106810316 ATTCCAGAATGTCATATAGTTGG + Intergenic
995026962 5:107434915-107434937 ATTTCAGAATGTAATACATTAGG - Intronic
995215229 5:109588149-109588171 TTTCCAGAATGTCATAGAGTTGG - Intergenic
995800743 5:115991266-115991288 GTTCCAGAATGTCATATAGTTGG + Intronic
995821326 5:116236619-116236641 CTTCTAGAATGTCATATAGTTGG - Intronic
995999987 5:118349027-118349049 TTTCCAGAATGTCATATACTTGG + Intergenic
996322197 5:122231467-122231489 TTTCCAGAATGTCATATAGTTGG - Intergenic
996360820 5:122644028-122644050 TATTCAGAATGTCATGTAGTTGG - Intergenic
996408728 5:123132139-123132161 TTTTAAGTATGACATAAAGTAGG - Intronic
996433792 5:123411612-123411634 TTTCCTGAATGTCATATAGTTGG - Intronic
996458527 5:123713627-123713649 TTTCCAGAATGCCATAAAGTTGG + Intergenic
996600538 5:125257827-125257849 CTTTCAGAATATCTTAAATGTGG + Intergenic
996809358 5:127497843-127497865 TTTCCAGAATGTCATATACTTGG - Intergenic
996940266 5:128996251-128996273 CCTTGAGAATGTCAAAATGTGGG - Intronic
997019367 5:129979815-129979837 TTTCCAGAATGTTATATAGTTGG + Intronic
997054924 5:130430821-130430843 TTTCCAGAGTGTCATATAGTTGG - Intergenic
997128246 5:131250494-131250516 TTTCCAGAATGTCATATATTTGG - Intronic
997333472 5:133085330-133085352 TTTCCAAAATGTCATATAGTTGG - Intronic
997379650 5:133426448-133426470 ATTGGAGAATGTCATGAAGTTGG + Intronic
997399991 5:133594915-133594937 CTTTTAAAATGTCATTAAGTAGG - Intronic
997406227 5:133649086-133649108 TTTCCAGAATGTCATATGGTTGG + Intergenic
997495836 5:134324618-134324640 TTTCCAGAATATCATATAGTTGG - Intronic
997753436 5:136372155-136372177 TTTCCAGAATGTCATATAGTTGG - Intronic
998178959 5:139922875-139922897 TTTCCAGAATGTCTTATAGTTGG - Intronic
998185042 5:139972427-139972449 ATTAAAGAATGTCATAAACTGGG + Intronic
998187066 5:139988562-139988584 TTTCCAGAATGTGATACAGTTGG - Intronic
998189362 5:140009879-140009901 TTTCCAGAATGTCATATAGTTGG - Intronic
998361850 5:141595093-141595115 TTTCTAGAATGTCATATAGTTGG - Intronic
998518184 5:142774801-142774823 TTTCCAGAATGTCATGTAGTTGG + Intronic
998548147 5:143049736-143049758 CTTTAAGAATACCAGAAAGTTGG - Intronic
998962257 5:147501233-147501255 TTTTCAGAGTGTCATATAGTGGG - Intronic
999044695 5:148454393-148454415 CTTGCCAAATGTCACAAAGTTGG - Intronic
999189589 5:149737128-149737150 TTTCCAGAATGTCATATAGTTGG + Intronic
999427827 5:151503009-151503031 TTTCCAGCATGTCATATAGTTGG - Intergenic
999641626 5:153678711-153678733 CTTTCAGGACGTCATTAAGATGG - Intronic
999713122 5:154336049-154336071 TTTCCAGAATGTCATGTAGTTGG + Intronic
999740877 5:154550525-154550547 TTTTCAGAATGTCATACAGTTGG + Intergenic
999987640 5:157019908-157019930 TTTTCAGAATGTCATATAATTGG - Intergenic
1000501452 5:162056187-162056209 TTTCCAGAAAGTCATATAGTTGG - Intergenic
1000811686 5:165870747-165870769 CTCTCAGAAAGTCTTAGAGTTGG + Intergenic
1000937446 5:167320099-167320121 TTTTCATCATATCATAAAGTGGG - Intronic
1001538607 5:172520392-172520414 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1001636952 5:173217161-173217183 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1001791634 5:174462554-174462576 TTTCCAGAATTTCATTAAGTTGG + Intergenic
1001946816 5:175785994-175786016 TTTCCAGAATGTCATATAGTTGG + Intergenic
1001968201 5:175929857-175929879 TTTCCAGAATGTCCTATAGTTGG - Intronic
1002249245 5:177913953-177913975 TTTCCAGAATGTCATATAGTTGG + Intergenic
1003033431 6:2622496-2622518 TTTCCAGAATGTCATATAGCTGG + Exonic
1003086811 6:3066957-3066979 TTTCCAGAATGTCACATAGTTGG + Intronic
1003217684 6:4129678-4129700 TCTTCAGAATTTCATGAAGTAGG - Intronic
1003404715 6:5818837-5818859 TTTCCAGAATGTCATACAGTTGG + Intergenic
1003481916 6:6542398-6542420 TTTCCAGAATGTCATACAATTGG + Intergenic
1003700900 6:8463753-8463775 TGTTCAGAAGGTCATATAGTTGG + Intergenic
1003843120 6:10143271-10143293 TTTCCAGAATGTCACAGAGTTGG - Intronic
1003854431 6:10258779-10258801 TTTCCAGAATGTCATAGGGTTGG - Intergenic
1004039722 6:11963547-11963569 TTTTCAGAATGTCATGGATTTGG + Intergenic
1004190865 6:13462333-13462355 ATTTGTGAATGTCATAAATTAGG + Intronic
1004532310 6:16464703-16464725 TTTCCAAAATGTCATAAAGTTGG - Intronic
1004588136 6:17022547-17022569 TTTCCAGAATGTCATACAGTTGG + Intergenic
1004761956 6:18677162-18677184 CTTTCAGCATCACAGAAAGTTGG - Intergenic
1004792705 6:19044963-19044985 TTTCCAGAATGTCATATAATTGG + Intergenic
1004794128 6:19062197-19062219 TTTTCAGAATGTTATCTAGTTGG + Intergenic
1004799141 6:19126727-19126749 TTTCCAGAATGTCATATAATTGG - Intergenic
1005053788 6:21710751-21710773 CTTTGAGAAAGTCATAGGGTGGG + Intergenic
1005564470 6:27076821-27076843 TTTCCAAAATGTCATATAGTTGG + Intergenic
1005680696 6:28205130-28205152 TTTTCAGGATGTCATCTAGTTGG - Intergenic
1005728778 6:28675602-28675624 TTTCCAGAATATCATATAGTTGG - Intergenic
1006528281 6:34627129-34627151 TTTCCAAAATGTCATAGAGTTGG + Intronic
1006873063 6:37270875-37270897 TTTCCAGAATGTCATGTAGTTGG - Intronic
1007038082 6:38696612-38696634 CTTTCAGAAAGTGATTAGGTAGG - Intronic
1007117358 6:39352495-39352517 GTTCCAGAATGTTATATAGTTGG + Intronic
1007123544 6:39403377-39403399 TTTTCAGAATGTCATATAGCTGG + Intronic
1007365038 6:41385340-41385362 TTTCCAGAATGTCATATAGTTGG + Intergenic
1007796783 6:44355226-44355248 TTTCCAGAATGACATATAGTTGG + Intronic
1007883264 6:45191337-45191359 TTTTCAGAATTTCATATAGTTGG - Intronic
1007919883 6:45597237-45597259 CTCTCAGAATATTATAAACTGGG + Intronic
1008134796 6:47762080-47762102 TTTCCAGAGTGTCATATAGTTGG + Intergenic
1008235399 6:49040677-49040699 TTTCTAGAATGTCATACAGTAGG + Intergenic
1008367000 6:50692882-50692904 TTTCCAGAATATCATATAGTTGG + Intergenic
1008444687 6:51574360-51574382 TTTCCAGAATGTCAAATAGTTGG - Intergenic
1008485574 6:52031298-52031320 CTTTCAGTTTATCACAAAGTTGG - Intronic
1008619679 6:53259368-53259390 CATTCAGAAAGTCTAAAAGTGGG - Intergenic
1008772532 6:54996491-54996513 ACTTAAGAATGTCATTAAGTAGG + Intergenic
1008788511 6:55199278-55199300 AATGCAGCATGTCATAAAGTTGG + Intronic
1008858567 6:56121309-56121331 TTTTCAGCATATCATATAGTTGG - Intronic
1008920163 6:56835113-56835135 TTTACAGAATGTCATATAGTTGG - Intronic
1009004037 6:57759584-57759606 TTTTTGGAATGTCATATAGTAGG + Intergenic
1009716371 6:67402282-67402304 TTTCCAGGATGTTATAAAGTTGG + Intergenic
1009730284 6:67593808-67593830 TTTTCAGAATGTCATATAGTTGG - Intergenic
1009764383 6:68050619-68050641 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1009765614 6:68070998-68071020 CTTCCAGAATGTCATATAGTTGG - Intergenic
1010131914 6:72504147-72504169 ATTTCAGAATGAGAAAAAGTAGG - Intergenic
1010151558 6:72738823-72738845 TTTCCAGAATGTCATATAGTTGG - Intronic
1010348862 6:74847447-74847469 TTTCTAGAATGTCATATAGTTGG + Intergenic
1010587399 6:77670454-77670476 CTTGCCCAATGTCATATAGTAGG - Intergenic
1010741889 6:79516527-79516549 GTTTTAGGATGTCAGAAAGTTGG - Intronic
1010794417 6:80102917-80102939 TTTCCAGAATGTCATATAGATGG + Intergenic
1010801656 6:80183807-80183829 TTTCCAGAATGTCATATAATTGG + Intronic
1010999939 6:82576601-82576623 TTTTCAGAATGTCATATAAATGG - Intergenic
1011005837 6:82644690-82644712 TTTTCAGAATGTTATATACTTGG - Intergenic
1011007694 6:82665905-82665927 CTTTCAGAATGTTATATTGTTGG - Intergenic
1011023398 6:82839349-82839371 TTTTCAGAATGTCATATAATTGG - Intergenic
1011073559 6:83412753-83412775 TTTTCAGAATGTCATATAAATGG - Intronic
1011080782 6:83488495-83488517 TTTCCAGAATGTCAGATAGTTGG + Intergenic
1011268898 6:85555492-85555514 TTTCCAGAATGTTATATAGTTGG - Intronic
1011511516 6:88106538-88106560 GGATCAGAATGTCATAAGGTTGG + Intergenic
1011566893 6:88684637-88684659 TTCTCAGAATATCATATAGTTGG - Intronic
1011636515 6:89379608-89379630 CTTGCAGAATGTCAGGAAGCTGG - Intronic
1011658328 6:89571992-89572014 TTTTCAGAATGTCATGTTGTTGG + Intronic
1011694524 6:89900018-89900040 TTTCCAGAATGTCATACAGTTGG + Intergenic
1011880655 6:92020422-92020444 TTTCCAGAACGTCATAGAGTAGG + Intergenic
1012048149 6:94304905-94304927 TTTCCAGTATGTCATATAGTTGG - Intergenic
1012122953 6:95389732-95389754 TTTCCAGAATGTCATATATTTGG + Intergenic
1012138905 6:95596113-95596135 TTTCCAGAAGGTCATATAGTTGG - Intronic
1012253058 6:97000954-97000976 TTTCCAGAATGTCATATAGTTGG - Intronic
1012312640 6:97746679-97746701 TTTTCAGAATGTAATATAGCTGG + Intergenic
1012320943 6:97844684-97844706 TTTTCAGAATGTCATATTGTTGG + Intergenic
1012385561 6:98678065-98678087 TCTTCAGAATGTCATGTAGTTGG - Intergenic
1012511045 6:100002291-100002313 CTAACATAATGTCATAAATTAGG - Intergenic
1012619184 6:101318203-101318225 TTTCCAGAATGTCATATAATTGG + Intergenic
1012623680 6:101379673-101379695 TTTCCAGAATGTCATATAGTTGG + Intergenic
1012658288 6:101853851-101853873 TTTCCAGAATGTCACATAGTTGG - Intronic
1012704886 6:102511444-102511466 CTTCTAGAATGTCATATTGTTGG + Intergenic
1012729328 6:102861287-102861309 TTTCCAGAATTTCATATAGTTGG - Intergenic
1012763579 6:103333969-103333991 TTTCCAGAATGTCATATGGTTGG - Intergenic
1012781252 6:103560407-103560429 TTTCCAGAATGTCATATAGTTGG + Intergenic
1012926014 6:105268672-105268694 TTTTCAGAATGCCATATAGTTGG - Intergenic
1013031478 6:106337581-106337603 TTTCCAGAATGTCATACAGTTGG + Intergenic
1013114931 6:107095815-107095837 TTTCCAGAATGTCGTGAAGTTGG - Intronic
1013306763 6:108854956-108854978 TTGCCAGAATGTCATATAGTTGG + Intronic
1013321654 6:108996962-108996984 TTTCCAGAATGTTATATAGTTGG - Intronic
1013321846 6:109000059-109000081 TTTCCAGAATGTCATACAGCTGG - Intronic
1013675787 6:112460881-112460903 CTTTCAGAATGTCATATGGTTGG + Intergenic
1013931076 6:115533636-115533658 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1014121800 6:117734448-117734470 TTTCCAAAATGTCATATAGTTGG + Intergenic
1014324263 6:119972264-119972286 TTTCCAGAATGTTATATAGTTGG - Intergenic
1014394570 6:120909620-120909642 TTTCCAGAATGTCATATAGTTGG + Intergenic
1014784732 6:125605970-125605992 TTTCCAGAATGTCATATAATTGG - Intergenic
1014819973 6:125977280-125977302 TTTGCAGAATGTCATATGGTTGG + Intronic
1014972903 6:127840871-127840893 TTTTCAGAGCGTCATATAGTTGG - Intronic
1015049451 6:128821649-128821671 TTTACAGAATGTCATATAGTTGG - Intergenic
1015199385 6:130562045-130562067 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1015242787 6:131044536-131044558 ATTTCAGCAAGTCATAAAATGGG + Intronic
1015712142 6:136153790-136153812 CTTTATGAATGTCAGAAAGGGGG + Intronic
1015715749 6:136190400-136190422 CTTTGAGAATGCCATAGAGATGG - Intronic
1015749244 6:136543692-136543714 TTTCCAGAATGTCATAAAAGTGG - Intronic
1015789202 6:136949687-136949709 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1015885875 6:137918139-137918161 TTTCCAGAATGTCATTTAGTTGG - Intergenic
1016165186 6:140933234-140933256 TCTCCAGAATGTCACAAAGTTGG + Intergenic
1016221309 6:141673725-141673747 TTTCCAGAATGTCATATATTTGG - Intergenic
1016230849 6:141802044-141802066 TTTCTAGAATGTCATATAGTTGG - Intergenic
1016233806 6:141837108-141837130 TTTATAGAATGTCATAGAGTTGG - Intergenic
1016242682 6:141950294-141950316 TTTCAAGAATGTCATACAGTTGG + Intergenic
1016396849 6:143632825-143632847 TTTTCAGAACATCATATAGTTGG + Intronic
1016945607 6:149529917-149529939 TTTTCAAAATGTCATATAGTTGG - Intronic
1017068758 6:150553123-150553145 TTCTCAGAAGGTCATATAGTGGG + Intergenic
1017157996 6:151339804-151339826 TTTTCAGAATGTCATATAGTTGG + Intronic
1017230068 6:152064178-152064200 TTCTCAGAATGTCTTGAAGTTGG - Intronic
1017501451 6:155026950-155026972 CATGCAGAATATCATAAAGGTGG - Intronic
1017828452 6:158101144-158101166 TTTCCTGAATGTCATAGAGTTGG + Intergenic
1017885308 6:158594411-158594433 TTTCCAGAATGTCATCTAGTTGG + Intronic
1017951581 6:159139536-159139558 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1018335856 6:162788230-162788252 TTTCCAGAATGTCATGCAGTTGG + Intronic
1018406608 6:163490672-163490694 CTTTCAAAATGAAATAAATTTGG - Intronic
1018546660 6:164944578-164944600 TTTCCAGAATGTCATATAGTTGG - Intergenic
1018585540 6:165353654-165353676 TTTCCAGAATGTCATATAGTTGG - Intronic
1018863382 6:167729590-167729612 TTTCCAGAATGTCATACAATTGG - Intergenic
1020062825 7:5165390-5165412 TTTTCTGAATGTAATATAGTTGG - Intergenic
1020165432 7:5803948-5803970 TTTTCTGAATGTAATATAGTTGG + Intergenic
1020438875 7:8196278-8196300 TTTTCAGAATGTCATATAATTGG - Intronic
1020498211 7:8883584-8883606 TTCTCAGAATGTCATATAATTGG - Intergenic
1020512768 7:9079776-9079798 TTCCCAGAATGTCATACAGTTGG + Intergenic
1020587836 7:10092755-10092777 TTTTAAGAATGTCATACAGTTGG + Intergenic
1020612692 7:10420277-10420299 CTTTCACTATGTCTTCAAGTTGG + Intergenic
1020636769 7:10705553-10705575 TTCCCAGAATGTCATATAGTTGG - Intergenic
1021135810 7:16964195-16964217 CTTTCAAAATGTTATAGAGCTGG - Intergenic
1021209643 7:17831685-17831707 ATTTCAGAATGTCTAAAAGGTGG + Intronic
1021730868 7:23594400-23594422 TTGTCAGAATGTCATAAGTTTGG - Intergenic
1022480095 7:30737454-30737476 TTTCCAGAATGTCATATAGTTGG + Intronic
1022625074 7:32026938-32026960 TTTCCAGAATGTCATATAGTTGG - Intronic
1022805016 7:33812858-33812880 TTTTCAAAATATCATATAGTTGG - Intergenic
1022893631 7:34726775-34726797 TTTCCAGAATGTCATATACTTGG - Intronic
1022899902 7:34797114-34797136 TTTCCAGAATGTCATAAAGTTGG - Intronic
1023096349 7:36663534-36663556 TTTCCAGGATGTCATATAGTTGG + Intronic
1023172998 7:37407593-37407615 TTTCCAGAATGACATATAGTTGG - Intronic
1023407908 7:39855354-39855376 TTTCTAGAATGTCATATAGTTGG + Intergenic
1023425414 7:40030737-40030759 TTTTCAGAATGTCATGTAGTTGG + Intronic
1023524600 7:41086596-41086618 TTTTCAGAATGTCACATAGTTGG + Intergenic
1023591082 7:41781057-41781079 TTACCAGAATGTCATATAGTTGG + Intergenic
1023596878 7:41838856-41838878 TTTCCAGAATATCATATAGTTGG + Intergenic
1023643686 7:42287227-42287249 CTTCCAGAATGTCATATAAATGG - Intergenic
1023685920 7:42735658-42735680 TTTTCAGAATGTTATACAGTTGG - Intergenic
1023902639 7:44494932-44494954 TTTTCAGAATGTCATATAATTGG - Intergenic
1023903399 7:44502747-44502769 TTTACAGAATGTCATATAGTTGG + Intergenic
1023962992 7:44943193-44943215 TTTCCAGAATGTCATATTGTTGG - Intergenic
1024035993 7:45507916-45507938 TTTCCAGAATGTTATATAGTCGG + Intergenic
1024132224 7:46365042-46365064 TTTCCAGAATGTCATATAGTTGG + Intergenic
1024175221 7:46833492-46833514 TTTTCAGAATGTCTTATAATTGG - Intergenic
1024634989 7:51279831-51279853 TTTCCAGAATGTCACAGAGTTGG + Intronic
1024768374 7:52687993-52688015 TTTCCAGAATGTCATATATTTGG + Intergenic
1024772421 7:52738786-52738808 TTTCCAGAATGTCATATAGTTGG + Intergenic
1024786616 7:52914243-52914265 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1024794004 7:53001653-53001675 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1024847309 7:53661816-53661838 TTTCCAGAAAGTCATACAGTTGG + Intergenic
1024854789 7:53765408-53765430 ATTTCAGAATGTCATAAAGTTGG + Intergenic
1024923232 7:54583316-54583338 TTTCCAGAATGTCATATACTTGG - Intergenic
1025272044 7:57531223-57531245 TTTCCAGAATATCATAGAGTTGG - Intergenic
1025712222 7:63923013-63923035 TTTACAGAATGTCATATAGTTGG - Intergenic
1025798576 7:64762600-64762622 CTTTGAGAATCTCAAAAAATAGG + Intergenic
1025964897 7:66259977-66259999 TTTCCAGAATGTCATGGAGTTGG + Intronic
1026071575 7:67125789-67125811 TTTCCAGAATGTCATATAGTTGG + Intronic
1026267946 7:68811601-68811623 TTTCCAGAATGTCACATAGTTGG - Intergenic
1026599376 7:71763164-71763186 TTTTTAGAATGTCATATAATTGG + Intergenic
1026705320 7:72686476-72686498 TTTCCAGAATGTCATATAGTTGG - Intronic
1026884283 7:73929252-73929274 TTTCCAGAATGTCATATAGTTGG + Intergenic
1027301640 7:76843835-76843857 TTTTCAGAATGTCATATCATTGG - Intergenic
1027422518 7:78031133-78031155 ATTTGAGAATGTCATACAGATGG - Intronic
1027519682 7:79189842-79189864 TTTCCAGAATGTCCTATAGTTGG + Intronic
1027836552 7:83251271-83251293 TTTCCAGAGTGTCATAGAGTTGG + Intergenic
1027844907 7:83360661-83360683 CCTTCAGAATGTCATACATGAGG + Intergenic
1027983595 7:85256821-85256843 TTTCTAGAATGTCATATAGTTGG + Intergenic
1028099806 7:86805652-86805674 TTTACAGAATGACATATAGTTGG + Intronic
1028281957 7:88941533-88941555 TTTCCAGAAGGTCATATAGTTGG - Intronic
1028545437 7:91993830-91993852 CATTAAGAATGTCAGCAAGTTGG + Intronic
1028718042 7:93996842-93996864 CTTTCAAAATGTAATAAGGTTGG - Intronic
1028770150 7:94610129-94610151 CTTCCAGAATGTCATATAATTGG - Intronic
1028807875 7:95049741-95049763 TTTTCAGAATGTACTATAGTTGG + Intronic
1028913673 7:96235809-96235831 CTTTCCGAAGGTCAAAATGTGGG + Intronic
1028926501 7:96362302-96362324 TTTTGAGAATGACATATAGTTGG + Intergenic
1028951449 7:96640497-96640519 TTTCCAGAATGTCATATAGTTGG - Intronic
1029232861 7:99085815-99085837 TTTCCAGAATGTCACATAGTTGG + Intronic
1029846204 7:103414487-103414509 TTTTTAGAATGTCATTCAGTTGG + Intronic
1029882857 7:103835218-103835240 TTTCCAGAATGTGATACAGTTGG - Intronic
1030098774 7:105925872-105925894 TTTCCAGAATGTCATACAGTTGG + Intronic
1030180074 7:106697528-106697550 TTTCCAGAATGTTATATAGTTGG + Intergenic
1030538133 7:110794419-110794441 TATCCAGAATGTCATATAGTTGG - Intronic
1030556688 7:111033736-111033758 ATATCAGAATGTCATATAGTTGG - Intronic
1030723867 7:112902059-112902081 TTTCCAGAATGTCATATAGTTGG - Intronic
1030859026 7:114600240-114600262 TTTCCAGAATGTCTTATAGTTGG + Intronic
1030992830 7:116321077-116321099 TTTTCAGAATGTCATACAACTGG - Intronic
1031225304 7:119029585-119029607 TTTCCATAATGTCATATAGTTGG - Intergenic
1031363884 7:120880674-120880696 CTTTCAGAATTTCATCAACTGGG + Intergenic
1031427992 7:121630999-121631021 TTTTCAGAATGTCAAATAGTTGG + Intergenic
1031602933 7:123734548-123734570 TTTCCAGCATGTCATATAGTTGG - Intronic
1031639996 7:124150883-124150905 TTTCTAGAATGTCATATAGTTGG + Intergenic
1031682946 7:124696863-124696885 CTTTCAGAAGATCATATGGTTGG - Intergenic
1032015350 7:128376599-128376621 TTTCCAGAATGTCATATAGTTGG + Intergenic
1032753105 7:134862491-134862513 TTTCCAGAATATCATATAGTTGG - Intronic
1032757277 7:134903087-134903109 ATTTCAGAATGTCACATAGTTGG - Intronic
1032911782 7:136440574-136440596 TTTTCATAATGTCATATAGTTGG + Intergenic
1032957678 7:136990438-136990460 TTTCCAGGATGTCATATAGTTGG + Intronic
1033139284 7:138810590-138810612 TTTCCAGGATGTCATATAGTTGG - Intronic
1033402669 7:141041793-141041815 TTTGCAGAATGTCATATAGTTGG - Intergenic
1033467346 7:141606882-141606904 TTTTTAAAATGTCATATAGTTGG + Intronic
1033717659 7:144019448-144019470 CTTTTAAAATGTCTTAAACTTGG + Intergenic
1033826764 7:145200571-145200593 TTTCTAGAATGTCATAAAGTTGG + Intergenic
1034081938 7:148287146-148287168 TTTCCAGAATGTCATATAATTGG + Intronic
1035136961 7:156713163-156713185 TTCCCAGAATGTCATATAGTTGG - Intronic
1035188641 7:157145620-157145642 TTTCCAGAATGTCATATAGTTGG + Intronic
1035319353 7:158018658-158018680 CTTTAAGAATATAAGAAAGTAGG + Intronic
1035453098 7:158991808-158991830 TTTTCAGAATGTCATAGAATTGG - Intergenic
1035610670 8:961748-961770 CTTTAACAATGTCAGAATGTCGG - Intergenic
1035627089 8:1078626-1078648 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1036177469 8:6552883-6552905 TTTCCAGAATGTCATACAGTTGG - Intronic
1036204599 8:6795754-6795776 TTTCCAGAGTGTCATAGAGTTGG + Intergenic
1036445453 8:8818090-8818112 CTTTCAGAATGTTCTAAGTTAGG + Intronic
1036462123 8:8962666-8962688 TTTCCAGAATGTCATACAGTTGG - Intergenic
1036462781 8:8968393-8968415 TTTCCAGACTGTCATATAGTTGG + Intergenic
1036580235 8:10067241-10067263 TTTCCAGAATGTCATATATTTGG + Intronic
1036622620 8:10434879-10434901 TTTCCAGAATGTCAGATAGTTGG + Intergenic
1036703270 8:11028181-11028203 TTTCCAGAATGTCATCTAGTTGG + Intronic
1037016780 8:13917556-13917578 TTTCCAGAATGTCACATAGTTGG + Intergenic
1037017208 8:13923718-13923740 TTTTTAGAATGTCTTATAGTTGG + Intergenic
1037105514 8:15102290-15102312 TTTCCAGAATGCCATATAGTTGG - Intronic
1037136565 8:15469915-15469937 TTTCTAGAATGTCATATAGTTGG - Intronic
1037148106 8:15598661-15598683 TTTTCAGAATGTCATAAAGTTGG + Intronic
1037192914 8:16148953-16148975 TTTCCAGAATGTCATATAGTTGG - Intronic
1037236996 8:16731811-16731833 ATTTGAATATGTCATAAAGTGGG + Intergenic
1037256002 8:16954550-16954572 CTTCCAGAATGTCATATTGTTGG - Intergenic
1037515827 8:19630696-19630718 TTTCCAGAATGTCATATAGTTGG + Intronic
1038031146 8:23641515-23641537 TTTTCAGAATGTCATATAATTGG + Intergenic
1038050809 8:23809032-23809054 TTGCCAGAATGTCATATAGTTGG + Intergenic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1038144044 8:24877506-24877528 TTTCCAGAATGTCATATAGTTGG - Intergenic
1038183927 8:25255451-25255473 TATCCAGAATGTCATATAGTTGG - Intronic
1038273154 8:26093581-26093603 TTTTCAGAATGTCATATAGTTGG - Intergenic
1038314815 8:26475145-26475167 TTTTTAGAATGTCATACAGTTGG + Intronic
1038324056 8:26558362-26558384 TTGCCAGAATGTCATAGAGTTGG - Intronic
1038419756 8:27425841-27425863 TTTCCAGAATCTCATATAGTTGG + Intronic
1038460483 8:27712187-27712209 TTTTCAGAATGTCACATAGTTGG + Intergenic
1038585155 8:28781703-28781725 TTTCCAGAACGTCATACAGTTGG - Intronic
1038604543 8:28986137-28986159 TTTCCAGAATGTCATATAGTTGG + Intronic
1039035415 8:33354079-33354101 CTTTCAAATTTTCAAAAAGTCGG - Intergenic
1039078502 8:33713673-33713695 TTTTCAGAAAGTGATATAGTTGG + Intergenic
1039544030 8:38394957-38394979 TTTCCAGAATGTCATATAGTTGG + Intronic
1039722879 8:40183909-40183931 TTTCCAGAATGTCATAAAGTTGG - Intergenic
1039782826 8:40804005-40804027 TTTCTAGAATGTCATATAGTTGG - Intronic
1039839531 8:41284055-41284077 CTTTAAGATTGTCAGCAAGTAGG + Intronic
1039862970 8:41475073-41475095 TTTCCAGATTGTCATATAGTTGG + Intergenic
1039925107 8:41922925-41922947 TTTTCAGAATGTCATATAATTGG - Intergenic
1040004810 8:42610937-42610959 TTTCCAGAATGTCATATAGTTGG - Intergenic
1040420542 8:47236170-47236192 TTTCCAGAATTTCATATAGTTGG - Intergenic
1040430024 8:47330578-47330600 TATCCAGAATGTCATACAGTTGG + Intronic
1040468950 8:47720078-47720100 TGTCCAGAATGTCATATAGTTGG + Intronic
1040690120 8:49927590-49927612 TTTCCAGAATGTCATATAGTTGG - Intronic
1040753594 8:50741789-50741811 TTTCCAGAATCTCATATAGTTGG - Intronic
1040754477 8:50755324-50755346 TTTTCAAAATGTCATATAGTTGG + Intronic
1040866612 8:52054381-52054403 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1040949599 8:52924067-52924089 TTTCCAGAATGTCATATCGTTGG + Intergenic
1041502032 8:58549485-58549507 TTTCCAGAATGTCACAATGTTGG + Intergenic
1041503730 8:58569530-58569552 TTTTCAAAATGTCGTATAGTTGG + Intronic
1041555745 8:59153082-59153104 TTTTCAGAATGTCATATAGTTGG + Intergenic
1041685426 8:60640438-60640460 TTTCCAGAATGTCATATAGTTGG - Intergenic
1041845559 8:62323877-62323899 TTTCCAGAATGTCATATATTTGG - Intronic
1042139029 8:65660992-65661014 TTTCCAGAATGTCATGAAGTTGG - Intronic
1042304873 8:67321075-67321097 TTTTAAGAATGTCATAAATGTGG - Intronic
1042319433 8:67459536-67459558 TTTCCAGAATGTCATCTAGTTGG - Intronic
1042366689 8:67945391-67945413 TTTTCAGAATGTCATGTAGTTGG - Intergenic
1042383162 8:68142359-68142381 TTTTCAGAACATCATATAGTTGG + Intronic
1042657647 8:71117570-71117592 TTTCTAGAATGTCATGAAGTTGG + Intergenic
1042660750 8:71151703-71151725 CTCCCAGAATGTCACATAGTTGG + Intergenic
1042677455 8:71337581-71337603 CTTTTAGAAAGTCTTATAGTAGG - Intronic
1043159950 8:76833950-76833972 TTTCCAGAATGTCATATAGTTGG + Intronic
1043172222 8:76979720-76979742 CTGTCAGAATGTCCTAAATTAGG - Intergenic
1043245754 8:77998724-77998746 TTTCCACAATGTCATACAGTTGG - Intergenic
1043250185 8:78062700-78062722 TTTTCAGAATGTCATATAATTGG - Intergenic
1043494386 8:80783946-80783968 TTTCCAGAATGTCATATAGTTGG + Intronic
1043639026 8:82425720-82425742 TTTCCAGAAAGTCATATAGTTGG + Intergenic
1043698246 8:83249737-83249759 TTTCCCGAATGTCATATAGTTGG - Intergenic
1043739676 8:83795090-83795112 TTTTCAGAATGCCATATAGTTGG - Intergenic
1043924316 8:86020067-86020089 CTTTCATAATGGGATACAGTTGG + Intronic
1044002050 8:86894756-86894778 TTTTTAGAATGTCATATAGTTGG + Intronic
1044080592 8:87877644-87877666 TTTACAGAATGTCATGTAGTTGG - Intergenic
1044088057 8:87966174-87966196 GTTTCAGACTGTCATATAATTGG + Intergenic
1044104236 8:88182978-88183000 TTTCTAGAATGTCATATAGTTGG - Intronic
1044125056 8:88450046-88450068 TTTTTGGAACGTCATAAAGTTGG - Intergenic
1044151705 8:88785460-88785482 GTTTCTAAATGTCAAAAAGTAGG + Intergenic
1044154380 8:88825210-88825232 CTTCCCGAACGTCATATAGTTGG - Intergenic
1044196950 8:89388924-89388946 CTTTGAGAATGCCATACAGGAGG + Intergenic
1044605885 8:94046924-94046946 TTTCCGGAATGTCATATAGTTGG + Intergenic
1044631215 8:94280377-94280399 CTTTCAGCAAGTCAGAAATTTGG + Intergenic
1044650972 8:94494694-94494716 CTTTCTGGATGCCATGAAGTGGG + Intronic
1044789398 8:95832374-95832396 TTTTCAGAATGACATATACTTGG - Intergenic
1044810817 8:96059466-96059488 CTTTAAGAAAGACTTAAAGTTGG - Intergenic
1044811214 8:96064354-96064376 TTTCCAGAATGTCATAATCTAGG + Intergenic
1044860433 8:96518039-96518061 CTTTCAGAATGTTTTGGAGTGGG + Intronic
1045053522 8:98349172-98349194 TTTCTAGAATGTCATATAGTTGG - Intergenic
1045104740 8:98881297-98881319 TTTCCAGAATGTCATATAGATGG - Intronic
1045154659 8:99454077-99454099 TTTTAAGAATGTCATATAATTGG + Intronic
1045351002 8:101339475-101339497 TTTCCAGAATGTCATATCGTTGG + Intergenic
1045499273 8:102732446-102732468 CTTTCTGAATTTAAAAAAGTAGG + Intergenic
1045618734 8:103950228-103950250 CTTGCAGAATATTATAACGTTGG + Intronic
1045619897 8:103963905-103963927 TTTCCAGAATGTCACATAGTTGG + Intronic
1045850784 8:106696189-106696211 TTTTTAGAGTGTCATATAGTTGG + Intronic
1045853314 8:106730449-106730471 TTTGCAGAGTGTCATATAGTTGG + Intronic
1045885606 8:107094113-107094135 TTTCCAGAATGTCATATAATTGG + Intergenic
1045995945 8:108361757-108361779 TTTCCAGAATGTCTTATAGTTGG + Intronic
1046054772 8:109066196-109066218 TTTCCAGAATGTCATACAGTTGG + Intergenic
1046065650 8:109193984-109194006 TTTCCAGAGTGTCATATAGTTGG + Intergenic
1046191637 8:110802808-110802830 TTTTCAGAATGTCATATAAATGG + Intergenic
1046206368 8:111003420-111003442 ATTCCAGAATGTCATATAGCTGG - Intergenic
1046214735 8:111128935-111128957 TTTACAGAATGTCAAATAGTTGG - Intergenic
1046501851 8:115087646-115087668 TTTTCAGAATGTCATACAACTGG + Intergenic
1046884344 8:119347123-119347145 TTTCCAGAATGTCATGGAGTTGG + Intergenic
1046929705 8:119829812-119829834 CTTTCTTAAGGGCATAAAGTTGG - Intronic
1047046509 8:121059014-121059036 TTTGCAGAATGTCATATAATTGG - Intergenic
1047050703 8:121108871-121108893 TTTCCAGAATGTCATATAGTTGG - Intergenic
1047137128 8:122092068-122092090 TTTCCAGAATGTCATATAGTTGG + Intergenic
1047161316 8:122383178-122383200 TTTCCTGAATGTCATATAGTTGG + Intergenic
1047660764 8:127033904-127033926 TTTCCAGAATGTCATATAGTTGG - Intergenic
1048089566 8:131224570-131224592 CATTCAAAATGTTAAAAAGTTGG + Intergenic
1048188715 8:132268153-132268175 CTTCTAGAATGTCATATAGTTGG + Intronic
1048318613 8:133380884-133380906 TTTTCAGAATGCCATATAGTTGG - Intergenic
1048414387 8:134210014-134210036 TTTTCAGGATGTCATATAATGGG + Intergenic
1048797477 8:138164431-138164453 CTTTCACAATGTCATATTTTAGG - Intronic
1048994191 8:139781423-139781445 TTTCTAGAATGTCATATAGTTGG - Intronic
1049072476 8:140367497-140367519 TTTCCAGAGTGTCATATAGTTGG - Intronic
1049320418 8:141993311-141993333 CTTCCAGAATGTCCTAGAGTCGG + Intergenic
1049552840 8:143268362-143268384 CTTTCATACTGTGATAGAGTAGG - Intronic
1049837009 8:144742731-144742753 CATCCAGAATGTCACATAGTTGG + Intronic
1050275318 9:3991657-3991679 AGTTCAGAATTTCATTAAGTAGG + Intronic
1050306362 9:4309496-4309518 GTTACAGAAGGTCATAAAATAGG + Intronic
1050500253 9:6290405-6290427 TTTCCAGAATGTCATATGGTTGG - Intergenic
1050601089 9:7252185-7252207 TTTTTAGAATGTCATATAGTTGG + Intergenic
1051047868 9:12897115-12897137 TTTTCAGAGTGTCATGTAGTTGG - Intergenic
1051746746 9:20301966-20301988 TTTCCGGAATGTCATAGAGTTGG + Intergenic
1051988865 9:23126159-23126181 TTTCCAGAAGGTCATATAGTTGG + Intergenic
1051989368 9:23132999-23133021 CTTTCACAAAATCATAAAGTTGG + Intergenic
1052033310 9:23652687-23652709 TTTCCAGAATGTCATATAGATGG + Intergenic
1052148588 9:25082050-25082072 TTTCCAGAATGTCAAATAGTTGG + Intergenic
1052166548 9:25337501-25337523 TTTCCAGAAGGTCATATAGTTGG - Intergenic
1052313070 9:27089511-27089533 TTTCCAGAATGTCATATAATTGG + Intergenic
1052332910 9:27288778-27288800 TTTCTAGAATGTCATATAGTTGG - Intronic
1052520569 9:29543186-29543208 TTCTCAGAATGTCATATATTTGG + Intergenic
1052636613 9:31114792-31114814 TTTCTAGAATGTCATATAGTTGG - Intergenic
1052792812 9:32891899-32891921 ATTTCAGGATTTCATGAAGTTGG - Intergenic
1053040879 9:34870485-34870507 TTTCCAGAATGTCATATAATTGG + Intergenic
1053041392 9:34876420-34876442 TCTCCAGAATGTCATATAGTTGG - Intergenic
1053621631 9:39825301-39825323 CTTTCCTACTGTCATAAATTAGG - Intergenic
1053624789 9:39858077-39858099 TTTCCAGAAGGTCATAAAGTTGG + Intergenic
1053837564 9:42157163-42157185 CTTTCCTACTGTCATAAATTAGG - Intergenic
1053880081 9:42585151-42585173 TTTCCAGAAGGTCATAAAGTTGG - Intergenic
1054219106 9:62392621-62392643 TTTCCAGAAGGTCATAAAGTTGG - Intergenic
1054231607 9:62516552-62516574 TTTCCAGAAGGTCATAAAGTTGG + Intergenic
1054726541 9:68657745-68657767 TTTACAGAATGTCACATAGTTGG - Intergenic
1054989897 9:71312820-71312842 TTTTCAGAATGTCATACAGCTGG - Intronic
1055005602 9:71502456-71502478 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1055072800 9:72184422-72184444 TTTCCAGAATGTCATATAGTTGG + Intronic
1055206612 9:73738306-73738328 TTTCCAGAATGTTATATAGTTGG + Intergenic
1055324063 9:75110313-75110335 TTTCCAGAATGTCATATAGTTGG + Intronic
1055340453 9:75276249-75276271 TTTTCAGAATGTCAAATAGATGG + Intergenic
1055526976 9:77144796-77144818 TTTCCAGAATGTCATATAGTTGG - Intergenic
1055576338 9:77663193-77663215 CTTGCAGAAGTTGATAAAGTAGG - Intergenic
1055743432 9:79415436-79415458 TTTCCAGAATGTCATATAGTTGG - Intergenic
1055850387 9:80621315-80621337 TTTCCAGAATATCATATAGTTGG - Intergenic
1055863559 9:80784910-80784932 TTTACAGAATGTCATATAATTGG + Intergenic
1055875166 9:80933405-80933427 CTTTCAGATTGACATTGAGTTGG + Intergenic
1055879614 9:80984309-80984331 TTTTCAGAATGCCATATGGTTGG + Intergenic
1055997483 9:82176021-82176043 TTTTGAGAATGTCGTATAGTTGG + Intergenic
1056096895 9:83264234-83264256 TTTTCAGAATGTCAATTAGTTGG - Intronic
1056205079 9:84311944-84311966 TTTCCAGAATGTCGTATAGTTGG + Intronic
1056259665 9:84835190-84835212 CTTTCAGAGTGGCATTTAGTAGG + Intronic
1056445055 9:86657414-86657436 TTTCCAGAATGTCATAGAGTTGG + Intergenic
1056749045 9:89332537-89332559 TTTCTAGAATGTCATATAGTTGG + Intronic
1056857583 9:90147184-90147206 TTTCCAGAATGTCATATAGTTGG + Intergenic
1057003326 9:91533046-91533068 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1057029187 9:91760785-91760807 CTTTCTCAATATCATGAAGTGGG - Intronic
1057209921 9:93194976-93194998 TTTCCAGAATGTCATCTAGTTGG - Intronic
1057309931 9:93935983-93936005 TTTCCAGAATGTCCTATAGTTGG - Intergenic
1057366707 9:94428887-94428909 TTTCCAGAATGTCATATACTTGG + Intronic
1057369858 9:94461413-94461435 CTTTTATACTGTCATGAAGTTGG + Intergenic
1057598711 9:96438649-96438671 CTTCCAGAATGTCATAGAGTTGG - Intergenic
1057656627 9:96959175-96959197 TTTCCAGAATGTCATATACTTGG - Intronic
1059090829 9:111356088-111356110 TTTCCAGAATGTCATATAGTTGG + Intergenic
1059195124 9:112364059-112364081 TCTTCAGAATGTCATATATTTGG + Intergenic
1059358133 9:113717276-113717298 CTTCTAGAATGTTGTAAAGTGGG + Intergenic
1059461847 9:114436149-114436171 GTTTCAGAATATCACATAGTTGG - Intronic
1059595658 9:115717742-115717764 CTGGCACAAGGTCATAAAGTGGG + Intergenic
1059603742 9:115810559-115810581 TTTCCAGAATGTCATATAATTGG - Intergenic
1059689163 9:116668143-116668165 TTTCCAGAATGTCATACAGTGGG + Intronic
1059762662 9:117353824-117353846 TTTCCAGAATGTCACATAGTTGG - Intronic
1060111143 9:120907181-120907203 TTTCCAGAATGTCATATAGTTGG + Intronic
1060234206 9:121851114-121851136 TTTTCAGAAAGTCATATTGTTGG - Intronic
1060334459 9:122708782-122708804 TTTCCAGAATGTCATATGGTTGG - Intergenic
1060382344 9:123188086-123188108 TTTCAAGAATGTCATATAGTTGG + Intronic
1060570556 9:124635229-124635251 TCTCCAGAATGTCATATAGTTGG + Intronic
1061392470 9:130325405-130325427 TTTCCAGAATGTCATATAGCTGG + Intronic
1062078904 9:134608398-134608420 TTTCCTGAATGTCATAGAGTTGG + Intergenic
1203445392 Un_GL000219v1:49201-49223 TTTCCAGAATGTCATATAATTGG + Intergenic
1185660354 X:1723022-1723044 TTTCCAGAATGTCATGGAGTTGG - Intergenic
1185852275 X:3500315-3500337 TCTCCAGAATGTCATAGAGTTGG - Intergenic
1186096333 X:6106599-6106621 TTTCCAGAATGTCCTATAGTTGG + Intronic
1186425423 X:9461018-9461040 TTTCCAGAATGTCATATGGTTGG + Intergenic
1186695640 X:12028701-12028723 CTTCCACAATGTCATATAGTTGG + Intergenic
1186822148 X:13300375-13300397 ATTCCAGAATGTCATATAGTTGG + Intergenic
1187181866 X:16950102-16950124 TTTTTAGAATGTCATATAGTTGG + Intronic
1187310991 X:18142454-18142476 TTTCAAGAATGTCATACAGTTGG - Intergenic
1187312357 X:18157474-18157496 CTTTCACACCATCATAAAGTTGG + Intergenic
1187643652 X:21322193-21322215 TTTCCAGAATGTCATATAGTGGG + Intergenic
1187736388 X:22308517-22308539 TTTCCAGAATGTCATATAGTTGG + Intergenic
1187873301 X:23782563-23782585 CTTTTAGAATTTCCTAAGGTAGG - Intergenic
1187899965 X:24018415-24018437 CCTTCAGAATTTCAAATAGTAGG + Intronic
1187911251 X:24113102-24113124 TTTCCAGAATGTCATATAGTTGG + Intergenic
1187934203 X:24320075-24320097 TTTTCAGAACATCATATAGTTGG + Intergenic
1187949579 X:24458587-24458609 TTTCCAGAATGTCATATAGTTGG - Intergenic
1188165822 X:26862367-26862389 CTTCCAGATTGTCATATAGTTGG + Intergenic
1188329062 X:28846142-28846164 TTTCCAGAATGTCATATAGTTGG + Intronic
1188428659 X:30079331-30079353 TTTTCAGAATGTCATATAGTTGG + Intergenic
1188444326 X:30240689-30240711 TTTCCAGAATGTCATATAGATGG + Intergenic
1188767838 X:34118303-34118325 TTTACAGAATGTCAAATAGTTGG - Intergenic
1188883751 X:35523886-35523908 TTATCAGAATGTCATATAGCTGG + Intergenic
1189001317 X:36950081-36950103 TTTCCAGAATGTCATAAAGTTGG + Intergenic
1189022639 X:37357130-37357152 TTTTCAAAATGTCATATAGTTGG + Intronic
1189058417 X:37725874-37725896 TTTCCAGAATGTTATATAGTTGG - Intronic
1189347182 X:40250939-40250961 TTTGCAGAATGTTATAGAGTTGG + Intergenic
1189395854 X:40622251-40622273 TTTTCAGAATGTCTGTAAGTTGG - Intergenic
1189465995 X:41277844-41277866 TTTCCAGAATGCCATATAGTTGG + Intergenic
1189547760 X:42059684-42059706 TTTCCAGAATGTCATGTAGTTGG + Intergenic
1189727213 X:43979551-43979573 TTTCCAGAATGTCATGTAGTTGG - Intergenic
1189775391 X:44465735-44465757 TTTCCAGAAGGTCATATAGTTGG + Intergenic
1189977000 X:46471694-46471716 TTTCTAGAATGTCATATAGTTGG + Intronic
1190011134 X:46786029-46786051 TTTCCAGAATGTCATATAGTTGG - Intergenic
1190150432 X:47942709-47942731 TTTCCAAAATGTCATATAGTTGG - Intronic
1190239871 X:48649495-48649517 TTTCCGGAATGTCATATAGTTGG + Intergenic
1190558441 X:51662503-51662525 TTTCCAGAATGTCATATAGTTGG - Intergenic
1190803141 X:53811463-53811485 TTTCTAGAATGTCATATAGTTGG - Intergenic
1190899970 X:54662111-54662133 TTTTCAGAACGTCATATAGTTGG + Intergenic
1190955807 X:55192337-55192359 CTTCCAAAATGTCCCAAAGTGGG - Intronic
1190957475 X:55209695-55209717 TTTCCAGAATGTCATACAGTTGG + Intronic
1191684655 X:63877998-63878020 TTTCCAGAATGTCATATGGTTGG - Intergenic
1191872201 X:65757082-65757104 TTTCTAGAATGTCATATAGTTGG + Intergenic
1192097810 X:68231718-68231740 TTTCCAAAATGTCATATAGTTGG - Intronic
1192381478 X:70620859-70620881 TTTCCAGAATGTCATACAGTTGG - Intronic
1192384578 X:70653957-70653979 TTTTCAGAATGTCACATAATTGG - Intronic
1192431499 X:71115379-71115401 TTTCCAGAATGTCATATAGTTGG - Intergenic
1192836061 X:74801040-74801062 TTTCCAGAATGTCGTATAGTCGG + Intronic
1192862612 X:75093341-75093363 TTTCCAGAATGTCATATAGTTGG - Intronic
1192903668 X:75525969-75525991 CTTCCAGAATGTCATATAGTTGG + Intergenic
1193084316 X:77435502-77435524 TTTCCAGAATGTCATCTAGTTGG + Intergenic
1193172586 X:78353521-78353543 CTTTAAGACTGTCATTTAGTTGG + Intergenic
1193455181 X:81723496-81723518 TTTTCAGAATTGCATATAGTTGG - Intergenic
1194112401 X:89851509-89851531 TTTTCAGTATGTCATATAATTGG - Intergenic
1194369241 X:93050356-93050378 TTTCCAGAATGTCATATAATTGG + Intergenic
1194495002 X:94603783-94603805 CTTTCAAAATGTCATATAGTTGG - Intergenic
1194518536 X:94889808-94889830 TTTTAAGAATGTCAAATAGTTGG + Intergenic
1194632991 X:96309714-96309736 TTTCCAGTATGTCATATAGTTGG - Intergenic
1194669543 X:96713705-96713727 TTTCCAGAATGACATATAGTTGG + Intronic
1195982064 X:110590109-110590131 TTTCCATAATGTCATATAGTTGG - Intergenic
1196000341 X:110777064-110777086 ATTCCAGAATGTCATATAGTTGG + Intronic
1196155588 X:112425150-112425172 TTTCCAGAAGGTCATATAGTTGG + Intergenic
1196313348 X:114195491-114195513 TTTCCAGAATGTCATATAGTTGG - Intergenic
1196507726 X:116467894-116467916 TTTCCAGAATGTCATATAGTTGG + Intergenic
1196523308 X:116699951-116699973 TTTCCAGAATGTTATATAGTTGG + Intergenic
1197071338 X:122301380-122301402 TTTCCATAATGTCATATAGTTGG + Intergenic
1197212230 X:123837605-123837627 CTTCCAGAATGTCACATAGTTGG + Intergenic
1197241148 X:124124611-124124633 TCTCCAGAATGTCATATAGTTGG - Intronic
1197569719 X:128134015-128134037 TTTTTAGAATGCCATATAGTTGG - Intergenic
1197652269 X:129078276-129078298 ATTTCAAAGTGTCATAAACTTGG + Intergenic
1197803243 X:130374216-130374238 TTTCCAGAATGTCATATAGTTGG + Intergenic
1197976086 X:132167273-132167295 TTTCCAGAATGTCATAAAATTGG + Intergenic
1198096318 X:133383346-133383368 TTTCCAGAATGTCATATAGTTGG - Intronic
1198134694 X:133737127-133737149 TTTCCAGAATGTCACATAGTTGG - Intronic
1198136795 X:133760547-133760569 TTTCCAGAATGTCATATGGTTGG - Intronic
1198490905 X:137140378-137140400 TTTTCAGAATGTCATGTAATTGG - Intergenic
1198639706 X:138743308-138743330 TTTCCAGAATGTCATACAGTTGG - Intronic
1198842639 X:140875469-140875491 TTCCCAGAATGTCATATAGTGGG - Intergenic
1198874219 X:141205494-141205516 TTACCAGAATGTCATATAGTTGG - Intergenic
1198990840 X:142513594-142513616 TTTCCAGAATCTCATAAATTTGG + Intergenic
1199110420 X:143927373-143927395 TTTTGAGAACGTCATACAGTTGG - Intergenic
1199377020 X:147124821-147124843 TTTTCAGAATGTAATATAATTGG + Intergenic
1199417842 X:147606711-147606733 TTTCCAGAATGTCATATAGTTGG + Intergenic
1199498803 X:148486386-148486408 TTTCCAGAATGTCATACAGTTGG - Intergenic
1199731344 X:150635650-150635672 CTCTCAGAGTAACATAAAGTTGG - Intronic
1199735534 X:150682821-150682843 TTTCCAGAATGTCACATAGTTGG - Intergenic
1199817892 X:151415503-151415525 TTTCCAGAATGTCATATTGTTGG + Intergenic
1199823451 X:151474057-151474079 TTTCCAGAATGTCATATAGTTGG + Intergenic
1199864896 X:151835596-151835618 TTTCCAGAATGTCATATAGTTGG - Intergenic
1200465055 Y:3506313-3506335 TTTTCAGTATGTCATATAATTGG - Intergenic
1200677437 Y:6166581-6166603 TTTCCAGAATGTCATATAATTGG + Intergenic
1200733210 Y:6765330-6765352 TTTCCAGAATGTCATACAGTTGG + Intergenic
1201157524 Y:11146303-11146325 CTCCCAGAATGTCATATAATAGG + Intergenic
1201965994 Y:19736606-19736628 TCTTCAGAATGTCAAAAAGTGGG - Intronic