ID: 1117788589

View in Genome Browser
Species Human (GRCh38)
Location 14:59314149-59314171
Sequence AATCCCAACCCTCAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117788589_1117788592 28 Left 1117788589 14:59314149-59314171 CCACTCTCCTGAGGGTTGGGATT 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1117788592 14:59314200-59314222 AAGAGATGTTAAAACCTAGTAGG 0: 1
1: 0
2: 1
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117788589 Original CRISPR AATCCCAACCCTCAGGAGAG TGG (reversed) Intronic
900082000 1:865403-865425 AAGCCCATCCCAGAGGAGAGTGG + Intergenic
903607868 1:24588347-24588369 TCTCCCATCCCTCAGGAGATTGG + Intronic
904599087 1:31664075-31664097 AATCCCAAACCTCTGGCCAGTGG - Intronic
907394243 1:54178366-54178388 AATCCCAACCCAGAGGGGACAGG + Intronic
907819370 1:57952238-57952260 CATGCCAATCCTCAAGAGAGGGG - Intronic
910811381 1:91240813-91240835 AAACCCAATATTCAGGAGAGGGG - Intergenic
916665394 1:166962425-166962447 ATACCCAACCCTCAGGAGAAGGG - Intronic
920539503 1:206767470-206767492 ACCCCCTACCCCCAGGAGAGAGG - Intergenic
920715284 1:208334905-208334927 AATCTCAACCCTTAGCAGAGGGG + Intergenic
922254102 1:223877153-223877175 AATTCAAACACTCAGAAGAGGGG - Intergenic
923229226 1:231968779-231968801 AATAACAATCCTCAGGAGAGGGG - Intronic
1065221007 10:23495909-23495931 ATTCCCTGCCCTCAGGAGACTGG - Intergenic
1068241165 10:54302412-54302434 AATCCTAACCCTCAAGATGGCGG + Intronic
1068620253 10:59174559-59174581 AATCCAAATCCTCAGCAGAAAGG + Intergenic
1069794447 10:71043205-71043227 TATCCCATCCCTAAAGAGAGGGG - Intergenic
1071146291 10:82576721-82576743 AATTCTAACCCCCAGGAAAGGGG + Intronic
1071779320 10:88825496-88825518 AATCCCAACCCACTGATGAGAGG - Intronic
1073038479 10:100581157-100581179 AAAACCCACCCTCAGGAGATTGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077964874 11:7119153-7119175 AATCCCAACCCCCAGTGCAGTGG + Intergenic
1078199507 11:9167532-9167554 AATCCCAGCACTGAGGCGAGTGG + Intronic
1079686900 11:23370590-23370612 AGACTCACCCCTCAGGAGAGTGG - Intergenic
1081282737 11:41230404-41230426 AATCCCTACCTTCAGTGGAGAGG + Intronic
1082627675 11:55503694-55503716 ATTCGCAGCCCTCAGGAGGGAGG + Intergenic
1083323501 11:61861917-61861939 GATCCCCACCCACTGGAGAGGGG - Intronic
1084468086 11:69339033-69339055 AATCCCAACGCTCCTCAGAGGGG - Intronic
1084519648 11:69655540-69655562 AGCCCCCACCCTCAGGGGAGAGG - Intronic
1089041929 11:115460128-115460150 TAGCCTAAACCTCAGGAGAGGGG - Intronic
1089155976 11:116402910-116402932 AAACCCAGCCCTCTGGGGAGTGG - Intergenic
1089607758 11:119651535-119651557 AATCCAAGCCCCCACGAGAGGGG - Intronic
1089967755 11:122667463-122667485 AATCTCCACCCTCAGGAAACTGG + Intronic
1092971231 12:13697188-13697210 ACTCCCACAACTCAGGAGAGAGG + Intronic
1096404533 12:51333902-51333924 GAGACCAAGCCTCAGGAGAGAGG + Intronic
1096554177 12:52393318-52393340 CATCCCAACTCTCAGGAGAGGGG + Intergenic
1098474470 12:70884235-70884257 AATCCCATCACTCAGGAGCAGGG + Intronic
1100245535 12:92753032-92753054 AATCCTAACCTTCAGTGGAGCGG - Intronic
1100870814 12:98908148-98908170 ACTCCCAACCCACAGCAGACAGG - Intronic
1100969409 12:100051800-100051822 AATCCCAGCACTTTGGAGAGAGG + Intronic
1103176609 12:118869452-118869474 ACTCCCTAACCTCTGGAGAGGGG + Intergenic
1103845752 12:123901046-123901068 AAGAGCCACCCTCAGGAGAGAGG - Intronic
1109252613 13:60038077-60038099 AAACCCAAAACTCAGGATAGTGG + Intronic
1110456667 13:75696868-75696890 AAAACCCACTCTCAGGAGAGTGG - Intronic
1110486303 13:76048387-76048409 AATCCTAACCCCCAAGAGAATGG - Intergenic
1113103816 13:106750699-106750721 TATCCCAACTCTCTGGAGACTGG - Intergenic
1113565826 13:111319123-111319145 AATCCCAACCCTCAAGATGATGG - Intronic
1113876078 13:113595564-113595586 AATCCCCAACCACAGGGGAGTGG - Intronic
1113878973 13:113612123-113612145 AAGGCCAAGCCTCAGCAGAGAGG - Intronic
1115101798 14:29710199-29710221 AAGCTCCACCCTCTGGAGAGTGG - Intronic
1116114290 14:40628666-40628688 AGTCCCAACCCTAGGGAAAGGGG - Intergenic
1117788589 14:59314149-59314171 AATCCCAACCCTCAGGAGAGTGG - Intronic
1118704955 14:68471893-68471915 AGTCCAAACCCTCAGGAAACTGG - Intronic
1119525740 14:75320897-75320919 AATCCCAAGCCCCAGGTGTGAGG - Intergenic
1119563375 14:75608524-75608546 CATCCCCACCCTCAGGACATAGG + Intronic
1119950377 14:78738462-78738484 AGACCCCACCCTCAGGACAGTGG + Intronic
1120496869 14:85248867-85248889 AATTCCAACCCTCAGTAGACAGG - Intergenic
1121285731 14:92734364-92734386 AATCCCAGCACTTAGGAAAGCGG + Intronic
1124151396 15:27181754-27181776 GATCCCAACGCTCAGAAGTGAGG + Intronic
1124883041 15:33659872-33659894 AATCCCAGGCCTCAGAAGATGGG + Intronic
1125412007 15:39415772-39415794 CACCCCAACCCACAGGAGAGGGG + Intergenic
1125532579 15:40423189-40423211 AATCCCAACACTTTGGAAAGTGG - Intronic
1128030608 15:64476742-64476764 AATCCCACCCCTCAGGGAACTGG - Intronic
1128107880 15:65057742-65057764 AATTCCAATTCTAAGGAGAGAGG - Intronic
1128584247 15:68834017-68834039 AATCTCAGCACTCAGTAGAGTGG - Intronic
1130296846 15:82653011-82653033 AATGCCCACCAACAGGAGAGTGG + Intergenic
1133211094 16:4263874-4263896 AAGCCCAACCCTCGGGAGCGTGG - Intronic
1133248230 16:4463311-4463333 AATCCCCTCCCACAGGGGAGGGG + Intronic
1134445240 16:14326117-14326139 TCTCCCAACCAGCAGGAGAGAGG - Intergenic
1135293795 16:21262214-21262236 AAGCCCAAAGCACAGGAGAGAGG + Intronic
1136276361 16:29181423-29181445 AATCCCAGCCCCCAGGGGTGTGG + Intergenic
1136682322 16:31975603-31975625 AATCCTTACCCTCAGGAGTGGGG - Intergenic
1136782581 16:32916771-32916793 AATCCTTACCCTCAGGAGTGGGG - Intergenic
1136887214 16:33937079-33937101 AATCCTTACCCTCAGGAGTGGGG + Intergenic
1140833798 16:78775038-78775060 GCTCCCCACCCTCAGGAGTGAGG - Intronic
1141061201 16:80872754-80872776 AATCCCAACACTCTGGAAGGTGG + Intergenic
1141850023 16:86638810-86638832 AATCCCAGCCAGCAGGCGAGGGG - Intergenic
1142080744 16:88147483-88147505 AATCCCAGCCCCCAGGGGTGTGG + Intergenic
1203085238 16_KI270728v1_random:1180759-1180781 AATCCTTACCCTCAGGAGTGGGG - Intergenic
1142537415 17:628611-628633 CATTCCAACTCTTAGGAGAGAGG - Intronic
1142851891 17:2708341-2708363 CACCCTAACCCTCCGGAGAGAGG + Intronic
1143973869 17:10815618-10815640 ATTGCCATCCCTCAGGGGAGAGG - Intergenic
1144215331 17:13050252-13050274 CATCCCAACCCTCAAGATAAGGG + Intergenic
1144391263 17:14795533-14795555 ATCCCTAACCCTCATGAGAGAGG - Intergenic
1146505005 17:33397213-33397235 ACTCCCAACCCTAAAGAGGGTGG + Intronic
1146840018 17:36145001-36145023 AATCCTAACCCCCAGGATAGTGG - Intergenic
1147142842 17:38468941-38468963 AATCCTTACCCTCAGGAGTGGGG - Intronic
1147770523 17:42865010-42865032 AATTCCATCCCGCAGGAAAGGGG + Intergenic
1148739484 17:49884495-49884517 CATCCCAGCTCTCAGGACAGGGG - Intergenic
1149342500 17:55701147-55701169 AATCCTATCTCTGAGGAGAGTGG + Intergenic
1151203941 17:72491067-72491089 TACCCCAACCCTCACCAGAGTGG - Intergenic
1151721818 17:75861253-75861275 AAACCCAGCCCTCTGAAGAGCGG + Intergenic
1152614562 17:81331783-81331805 AAATCCAGACCTCAGGAGAGGGG - Intergenic
1155263159 18:24064980-24065002 ATTCCCAACCCTAAGGAAAATGG + Intronic
1155367489 18:25063328-25063350 AAAGCCCACCCTCAGGAGGGGGG - Intronic
1158190179 18:54818703-54818725 AAGCCCCACAATCAGGAGAGAGG + Intronic
1163082509 19:14954127-14954149 GATCACAACCATCAGGTGAGGGG - Exonic
927706302 2:25298536-25298558 GTTGCCAAGCCTCAGGAGAGAGG + Intronic
929903716 2:46027915-46027937 AATCCCAACCTTCAAGAGGGAGG - Intronic
934566294 2:95343451-95343473 AGTCCCAACTCTCCGGAGTGGGG - Intronic
934764960 2:96875504-96875526 ACTCCCCAGCCTCAGGAGTGGGG - Intergenic
936164704 2:110110183-110110205 AATCCTAACCCGCAGAAGAAAGG + Intronic
937418020 2:121732675-121732697 AATCCCAACACTCAAAAGAGAGG + Intronic
938380953 2:130836500-130836522 AATCAGAACTCTCAGCAGAGAGG + Intergenic
938947578 2:136227007-136227029 AAACACAGCCCACAGGAGAGTGG - Intergenic
940643005 2:156366866-156366888 AATTCCAGCCCTAAGGAGATTGG + Intergenic
942169849 2:173279269-173279291 AATGACAACTCTCAGGAAAGAGG + Intergenic
943288538 2:186038065-186038087 AATCCCAACCCGCAGAAGGCAGG + Intergenic
944534380 2:200695112-200695134 ATTCCCATCCCTCAGGAGCAAGG - Intergenic
948713395 2:239840041-239840063 AATGCCCATCCACAGGAGAGAGG - Intergenic
949052583 2:241905068-241905090 AATCCCAGCCAGCAGGAGAAAGG - Intergenic
1169106344 20:2998490-2998512 ACTCCCAACTCTCTGGACAGTGG - Intronic
1169958919 20:11137087-11137109 AATCACAAGGCTGAGGAGAGGGG - Intergenic
1171372385 20:24670047-24670069 AAACCCAAACAACAGGAGAGGGG + Intergenic
1172888938 20:38249901-38249923 GAGCCCAAGTCTCAGGAGAGAGG - Intronic
1173934124 20:46846299-46846321 AGTCCCAAAGCTAAGGAGAGAGG + Intergenic
1177338416 21:19763666-19763688 AATCCTAACCCTAAGGAGATGGG + Intergenic
1177417995 21:20818974-20818996 CCTCCCAAAACTCAGGAGAGGGG - Intergenic
1178286704 21:31331540-31331562 ATTCCCAGTCCTCAGGAGTGTGG - Intronic
1179497372 21:41781270-41781292 AATCCCAGCACTCTGGAAAGTGG + Intergenic
1182510170 22:30814043-30814065 AATCCCAAAGCTGAGGCGAGTGG - Intronic
1183758246 22:39790778-39790800 AATCCCAACCCTAGTGAGAGAGG - Intronic
1184937928 22:47738760-47738782 AAGGCCTTCCCTCAGGAGAGAGG - Intergenic
950011208 3:9725159-9725181 CATCCCAGCCCTCTGGAGTGAGG - Intronic
950362163 3:12457181-12457203 AAACCCAACACCAAGGAGAGGGG - Intergenic
953282137 3:41569263-41569285 AATCTCCACCCTCTGGGGAGGGG - Intronic
954447984 3:50556975-50556997 AAGCCCACCCCGCAGGAGAGGGG + Intergenic
954558941 3:51539341-51539363 ATTCCCAGACCTCAGGAGAGGGG - Intergenic
956820527 3:72949874-72949896 AAACCTAGCCCTCATGAGAGTGG + Intronic
956850669 3:73225343-73225365 AATCCCAAACCTCACCAGTGCGG - Intergenic
960971784 3:123145106-123145128 AAACCCAACCATCTGGTGAGAGG - Intronic
961509846 3:127394099-127394121 AATCTCAAAGCCCAGGAGAGGGG + Intergenic
961773710 3:129268819-129268841 AATACTAACCCTCCTGAGAGTGG - Intronic
961944384 3:130670974-130670996 CATCCCAACCTACAGCAGAGGGG - Intronic
966832324 3:184020362-184020384 CTTCCCAACCCTCAGGCAAGGGG + Intergenic
966896252 3:184447417-184447439 AGACACACCCCTCAGGAGAGGGG - Intronic
967684062 3:192399251-192399273 AATCCCATTCATGAGGAGAGAGG - Intronic
969390221 4:6887176-6887198 ATAACCAACCCTTAGGAGAGAGG - Intergenic
969471540 4:7392229-7392251 CATCCTAACCCTCAGGGGACGGG - Intronic
969547088 4:7837280-7837302 AATCCTAACCCTCAAGAGGATGG + Intronic
969918077 4:10509850-10509872 AGTCCCTACCCCCAGGGGAGAGG + Intronic
970162737 4:13205468-13205490 AATCCCAACCCACAAGGAAGGGG - Intergenic
970407003 4:15773555-15773577 AATCCCATCCTTGAGGAGAGTGG + Intergenic
970782835 4:19759441-19759463 AATCCCAACACTTAGGTGGGAGG + Intergenic
971704261 4:30019285-30019307 AATCCTAACCCCCAGTAGAATGG + Intergenic
972641953 4:40933390-40933412 AATCTCAACCCACAGCAGATGGG + Intronic
974402771 4:61426597-61426619 AATGCCAACACTGGGGAGAGTGG + Intronic
977471900 4:97452749-97452771 TTTCCCAACTCTCAGCAGAGAGG - Intronic
977657737 4:99541999-99542021 AGGCCTAACACTCAGGAGAGTGG + Exonic
979821971 4:125186139-125186161 AATCCCAACACACTGGAAAGTGG - Intergenic
981295435 4:143125866-143125888 AATCCCAACACTCTGGAAGGTGG - Intergenic
982260708 4:153491951-153491973 AATCCCAACACTTTGGGGAGTGG - Intronic
985375925 4:189338660-189338682 TATCCCAACCTTTAGGAAAGAGG - Intergenic
988361671 5:30243541-30243563 AATCCCAAATCTGAGGAGTGGGG + Intergenic
991098713 5:62767916-62767938 AATCCTAACCCTCAAGATAATGG + Intergenic
991711124 5:69409424-69409446 ATTCCCAACCCTGAGCTGAGAGG - Intronic
992047488 5:72908805-72908827 AATCCCAACCCTACTGGGAGGGG + Exonic
992113516 5:73517918-73517940 GAACCCAACCTTCAGGAGTGAGG - Intergenic
992570331 5:78048837-78048859 AATCCCAACCAGTAGTAGAGTGG - Intronic
993882623 5:93380913-93380935 AATCCTAACCCTCAGTAAAATGG + Intergenic
995934740 5:117496415-117496437 AATTCCAAACCTTAGCAGAGTGG + Intergenic
997338213 5:133122531-133122553 AATCCCAAAACTCAGGACACTGG - Intergenic
998705703 5:144757487-144757509 AGACCCAATCATCAGGAGAGGGG + Intergenic
998891782 5:146753923-146753945 AAGCTCATCCCTCAGGAGACAGG - Intronic
1000272901 5:159703562-159703584 AATCCCACCACTTAGAAGAGAGG - Intergenic
1001157556 5:169286477-169286499 AATCCCAGCCCCCAGAAGTGAGG + Intronic
1003340913 6:5219999-5220021 ACTGCCAAGCTTCAGGAGAGTGG - Intronic
1003746077 6:9004165-9004187 AATAGCATCACTCAGGAGAGGGG - Intergenic
1005753418 6:28904298-28904320 AATCCCCACCCGCTGGAGCGGGG + Exonic
1006101751 6:31689952-31689974 GACCCCAGCCCTCAGGTGAGTGG + Intronic
1006920494 6:37624585-37624607 AATTCCCACCCTAGGGAGAGTGG + Intergenic
1007698250 6:43747369-43747391 AATACCAACTCTGAAGAGAGTGG - Intergenic
1007801439 6:44397103-44397125 AACCCCCAACCTCAGGGGAGGGG - Intronic
1011156876 6:84342974-84342996 AATCCCAACCCTCAAGGTGGTGG - Intergenic
1016924207 6:149325993-149326015 AATCCCAACACTTAGGTGGGAGG - Intronic
1017154374 6:151309801-151309823 AATCCCAAAGCTCAGAAGAAAGG - Intronic
1018420258 6:163634863-163634885 GATGCCAACCCTAAGGAGAAAGG - Intergenic
1018832248 6:167452120-167452142 AATCAGAACCCTTAGGAGTGGGG + Intergenic
1019386173 7:757403-757425 CATCCCACCCCTGAGGAGCGTGG + Intronic
1020366584 7:7387030-7387052 AATCCCATTCCTGAGGACAGAGG + Intronic
1022636492 7:32141143-32141165 AATCCCATCCCTCATAAGTGTGG + Intronic
1022972951 7:35533973-35533995 AATCCCACGTGTCAGGAGAGGGG + Intergenic
1024528345 7:50369509-50369531 AATTCCAACACTGGGGAGAGTGG - Intronic
1026344921 7:69465595-69465617 AGTCCCCACCTCCAGGAGAGGGG - Intergenic
1030624598 7:111830940-111830962 AATCCTAAGCCTAAGGAGGGAGG - Intronic
1030961421 7:115928100-115928122 ATTCCCAACACTCAGCTGAGAGG - Intergenic
1032591159 7:133193696-133193718 CATCTGAACCCTCAGAAGAGAGG + Intergenic
1037381371 8:18288441-18288463 AATCCCAACCAGTAGCAGAGAGG + Intergenic
1037879129 8:22564654-22564676 AATGCCAGCACTCAGGACAGTGG + Intronic
1039941831 8:42097917-42097939 AGTCCCAACCCACAGAAGATGGG - Intergenic
1040414713 8:47186149-47186171 AATCCCAATCCACAGGAGGCAGG - Intergenic
1040471521 8:47738506-47738528 ACTCCCAACCCCGAGGAGCGAGG - Exonic
1043818528 8:84834342-84834364 CATCTCAACCCTGGGGAGAGAGG - Intronic
1043960407 8:86411274-86411296 AATAACAACCTTAAGGAGAGAGG - Intronic
1045328856 8:101137904-101137926 ATTCCCAACCCTCCAGAAAGTGG - Intergenic
1046652076 8:116847004-116847026 GATACCATCCCTAAGGAGAGTGG + Exonic
1046773432 8:118138911-118138933 AATACCGACACTAAGGAGAGTGG + Intergenic
1047118351 8:121870686-121870708 AATCCCAAGCCTCAAGGTAGTGG - Intergenic
1047221398 8:122921473-122921495 GATCCAAACCCCCAGGGGAGGGG - Intronic
1047805506 8:128355375-128355397 CATCCTGACCCTCAGGAGACAGG + Intergenic
1048934830 8:139346160-139346182 AATCCCAAACCCCAGGAAAGGGG + Intergenic
1050325327 9:4491920-4491942 TATCCCCACCCTGAGGGGAGGGG - Intronic
1050555490 9:6785874-6785896 AATCCCAACACTCAGCACACTGG - Intronic
1051997394 9:23234252-23234274 AATCCCAACACTGAGAAGTGAGG - Intergenic
1052859501 9:33428296-33428318 AAACACAACCCTGAAGAGAGTGG + Intergenic
1056888797 9:90470013-90470035 AAACCCAACCCTCTGCAGAAAGG - Intergenic
1057895666 9:98906785-98906807 GATCCCAAACCTCAGGCCAGTGG - Intergenic
1058432362 9:104930125-104930147 AAGCCCAAGGCCCAGGAGAGCGG + Intergenic
1058579367 9:106438263-106438285 TTTCCCAACACTCTGGAGAGGGG + Intergenic
1059890050 9:118791592-118791614 AATGCCAACCTTGAGGACAGGGG + Intergenic
1059982721 9:119790863-119790885 AGTTCCAACCCTCAGGAGGAAGG + Intergenic
1060095524 9:120785774-120785796 AATCCCAACACTTTGGAGGGTGG + Intronic
1060607374 9:124927734-124927756 AATCCCAACCAGCAGGACAGAGG - Intronic
1061516859 9:131095206-131095228 AATCCAAACCCTTGGGTGAGTGG + Intergenic
1062476906 9:136732767-136732789 TGTCCCAACCCTCAGGGGTGTGG - Intergenic
1186903646 X:14086899-14086921 AATCCCAACCCCCAAGATAATGG - Intergenic
1189516492 X:41718020-41718042 ACTCCCAACCCTCCAGAGAGGGG + Intronic
1190542169 X:51488363-51488385 ATTCCCATACCTGAGGAGAGGGG - Intergenic
1195799773 X:108694870-108694892 AATCCCATCCCTGAGGACAATGG - Exonic
1196659889 X:118258753-118258775 AATCCCAACACAGAGGTGAGAGG - Intergenic
1196827603 X:119753198-119753220 AATGTGAACCATCAGGAGAGAGG - Intergenic
1198781426 X:140240449-140240471 AATACAAACCCTCAGGAAATTGG - Intergenic
1199602456 X:149550242-149550264 ACTCCCAACCCTGAAGACAGGGG + Intronic
1199647932 X:149929233-149929255 ACTCCCAACCCTGAAGACAGGGG - Intergenic