ID: 1117788721

View in Genome Browser
Species Human (GRCh38)
Location 14:59315341-59315363
Sequence AAGTCTACTTACAGCAGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117788721 Original CRISPR AAGTCTACTTACAGCAGCCA TGG (reversed) Exonic
904459345 1:30666397-30666419 TAGTCTAAAAACAGCAGCCAGGG + Intergenic
905154099 1:35958927-35958949 AAGTCTACTGACATTATCCATGG - Intronic
905641231 1:39591341-39591363 AAGTCAACTCACAGACGCCAAGG - Intergenic
905878558 1:41448933-41448955 CATTCTGCTTACAGCAGCCAGGG - Intergenic
916743866 1:167669469-167669491 ATGTCTATTTGCAGCAGGCAGGG + Intronic
917947233 1:179987276-179987298 AAAACTACTTACAGCAGCCTTGG - Exonic
919438786 1:197600222-197600244 CAGTTTACTTACAGCAGAGATGG + Intronic
921042087 1:211442523-211442545 AAGTGTAATTCCAGAAGCCAAGG + Intergenic
921919919 1:220656209-220656231 AAGTCTGCTTTAAGTAGCCATGG - Intronic
922109827 1:222546226-222546248 AAGTATAGTTACAGCAGCACTGG - Intronic
923115095 1:230928954-230928976 AAGACTACGAAGAGCAGCCAGGG - Exonic
923341649 1:233012570-233012592 AACTCTACTTGCTGCAGACATGG - Intronic
1063240989 10:4168999-4169021 AAGTCTACCAGCAGCAGCTAGGG - Intergenic
1064822009 10:19347573-19347595 AAATGAACTTACAGAAGCCACGG + Intronic
1065842811 10:29718435-29718457 AAGACTACTTCGAGTAGCCAGGG - Intronic
1073740955 10:106406381-106406403 AAGTCTCCACACAGCAGCCAGGG - Intergenic
1074936642 10:118188395-118188417 CATTCTACATACAGCAGCCTAGG - Intergenic
1077704965 11:4475983-4476005 AAGTTTACTGACAGGAGTCAGGG - Intergenic
1086140441 11:83492889-83492911 TATTCTCCTTACAGCAGCCAGGG + Intronic
1086972161 11:93093974-93093996 AAGTCTATCTACAGCTGTCATGG + Intergenic
1089004845 11:115082774-115082796 ATGCCTAGTGACAGCAGCCAGGG - Intergenic
1092358662 12:7817819-7817841 GAGTTTACTTACAGCAGCAGAGG + Exonic
1092371801 12:7922809-7922831 GAGTTTACTTACAGCAGCGGAGG + Exonic
1101517641 12:105451644-105451666 GGGTCTACTCCCAGCAGCCATGG + Intergenic
1101610277 12:106284867-106284889 TGGTCTCCTTACAGCAGCCAGGG + Intronic
1103785679 12:123431112-123431134 AGCTCTATTTACAGCAGCCAAGG + Intronic
1105728153 13:23186139-23186161 AAGGCTACTCAGACCAGCCAGGG - Intronic
1107442918 13:40444426-40444448 AACTCTACTTACTTCAGCAAAGG + Intergenic
1107968256 13:45616213-45616235 AAGTCCACTCACAGTGGCCAGGG - Intergenic
1111216976 13:85156655-85156677 GAGTGTACTTACACAAGCCAAGG - Intergenic
1113994510 14:16055181-16055203 AAGTCTGGTGCCAGCAGCCATGG + Intergenic
1114702133 14:24689720-24689742 ATGGCTACTTACAGAAGCAACGG + Intergenic
1117788721 14:59315341-59315363 AAGTCTACTTACAGCAGCCATGG - Exonic
1118717863 14:68573097-68573119 CAGTCAACTCCCAGCAGCCAGGG + Intronic
1119651434 14:76386853-76386875 AGGTCTCCTAACAGCACCCAGGG + Intronic
1120802235 14:88703498-88703520 AAGTCTATTTATAGCAACCTTGG + Intronic
1121059307 14:90889983-90890005 ATTTCTAATCACAGCAGCCAAGG + Intronic
1121851024 14:97221147-97221169 CAGTCTTCTTAAAGCAGCAAAGG - Intergenic
1122016172 14:98798593-98798615 AAGTCTATTTACAGGGGACATGG + Intergenic
1125451052 15:39808043-39808065 GAGTAGACTTGCAGCAGCCAAGG - Intronic
1126081841 15:44971178-44971200 CAGGCTACTTAGAGCCGCCACGG + Intronic
1126353158 15:47766172-47766194 AAGTATACTTACAGCATCCCTGG - Exonic
1128132544 15:65238667-65238689 ATCCCTTCTTACAGCAGCCAGGG + Intronic
1128716883 15:69915090-69915112 AGGTCTACAAACAGCAGTCAGGG + Intergenic
1130821111 15:87496580-87496602 AATTCTAGTTCCAGCTGCCAAGG - Intergenic
1132914503 16:2335698-2335720 AAGTCTACTTTAAGCATCCTAGG + Intronic
1136504169 16:30692210-30692232 ATGTCTCCACACAGCAGCCAGGG - Intergenic
1137592308 16:49700991-49701013 GAGCTAACTTACAGCAGCCAAGG - Intronic
1139441596 16:66970660-66970682 TAGTCTCCTTACAACAGCCCAGG - Intronic
1140090473 16:71834382-71834404 AAGTTTCCTTACAGCACCCCAGG - Intergenic
1151534440 17:74730686-74730708 CAGTCTGCTCTCAGCAGCCAGGG + Intronic
1158041019 18:53093759-53093781 CAGGCTACTCCCAGCAGCCAAGG - Intronic
1158159221 18:54461310-54461332 AAGTCTATTTACAATAGCCCAGG - Intergenic
1159252354 18:65896023-65896045 ACGTCAACGTCCAGCAGCCAAGG - Intergenic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1167564550 19:50248299-50248321 AATTCTCCATGCAGCAGCCAAGG - Intronic
926776993 2:16432601-16432623 AAATCTGCTTACACCATCCACGG + Intergenic
926983311 2:18594584-18594606 AAGTGTAGTTACTGCTGCCATGG - Intergenic
936916140 2:117640830-117640852 CATTCTACTTACTGCAGCCCAGG + Intergenic
941492020 2:166154163-166154185 ATGGCTATTTACAGCAGCAAGGG + Intergenic
942505314 2:176636269-176636291 AAAACTACTTACAGCAAACATGG + Intergenic
943240927 2:185382959-185382981 AAGACTTCTTTCAGCAGCCCTGG + Intergenic
943392771 2:187290420-187290442 AATTTTATTTACAGCAGCCTTGG - Intergenic
948074843 2:235157938-235157960 AAGTCCATTCCCAGCAGCCAGGG - Intergenic
948947410 2:241228017-241228039 AAGTCTAGTTGCAGCTGCCTCGG - Exonic
1170074922 20:12409128-12409150 GAGTCTAATTACAGTAGCAATGG + Intergenic
1170805536 20:19627469-19627491 AAGTCTACTTACACTTTCCATGG + Intronic
1171865868 20:30487348-30487370 AAGTCTGGTGCCAGCAGCCATGG - Intergenic
1171983674 20:31644710-31644732 CAGTCTTCCTACACCAGCCAGGG - Intronic
1173522609 20:43710916-43710938 AACTTTAATTACAGCTGCCAAGG - Intronic
1175193440 20:57226311-57226333 ACATCTACTCCCAGCAGCCAGGG - Intronic
1175522884 20:59613491-59613513 AAGGCTACTCCCAGCTGCCAGGG + Intronic
1175802106 20:61806739-61806761 ATGTCTGCTCACAGCAGCCGTGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178042453 21:28654338-28654360 AAGTCTACTAACAGCTTTCATGG + Intergenic
1180312581 22:11252223-11252245 AAGTCTGGTGCCAGCAGCCATGG - Intergenic
1180342656 22:11630150-11630172 AAGTCTAGTGCCAGCAGCCGCGG + Intergenic
1181956185 22:26589617-26589639 AAGTTAACTTGCAGCAGCCGTGG - Intronic
1184024334 22:41843616-41843638 AAGCCTGCTTACATCAGACAGGG - Intronic
951170481 3:19536203-19536225 AGGGGTACTTAGAGCAGCCATGG - Intergenic
952193288 3:31046548-31046570 AAGGCTACTGACAGTAGGCAGGG + Intergenic
955938927 3:64129583-64129605 AATTCTGCTTTCAACAGCCATGG - Intronic
957804551 3:85130702-85130724 AAGTCTACTTACAAAATCAATGG - Intronic
958525809 3:95257846-95257868 AAGCCTACTTAAAACAGTCATGG + Intergenic
959626461 3:108457562-108457584 AAGTCTTCTGAAAGAAGCCAAGG + Intronic
960512176 3:118563808-118563830 ATGTGTATTTACAGTAGCCAAGG + Intergenic
960576375 3:119233892-119233914 ATGTTTACTCACAGGAGCCAAGG - Intronic
966177017 3:177149386-177149408 TACTCTAATTACAGAAGCCAGGG + Intronic
967104846 3:186247332-186247354 AATTCTACCCACAGCACCCAAGG + Intronic
969159951 4:5247973-5247995 AAGTCTGCTCAGGGCAGCCATGG + Intronic
971365916 4:25977034-25977056 TAGTGTAGATACAGCAGCCAGGG - Intergenic
973659856 4:53093313-53093335 CATTCTTCTTTCAGCAGCCATGG - Intronic
975187184 4:71417443-71417465 AAGTCTACTTCCTTCAGGCATGG + Intronic
975620956 4:76295963-76295985 AAGCCTTCTTCTAGCAGCCATGG + Intronic
976726029 4:88216540-88216562 AGGTATAGTTACAGCAGCCTTGG - Intronic
976865822 4:89725126-89725148 AAGTTTATTTTCAGCACCCATGG + Exonic
980126644 4:128780666-128780688 CATTCTCCTTACAGCAGCTAGGG - Intergenic
980734813 4:136870854-136870876 AAGTCAGATTACAGTAGCCAAGG + Intergenic
980895493 4:138855782-138855804 AACTCTCCTGACAGCAGCCTAGG - Intergenic
985286346 4:188340239-188340261 ACATCTACTTACAGCACACATGG + Intergenic
987857510 5:23439980-23440002 AAGTATACCTACAACAGCCAAGG + Intergenic
991946511 5:71903006-71903028 AAGTCTATTCCAAGCAGCCATGG + Intergenic
994834661 5:104834077-104834099 AAGTTATCTTACAGAAGCCAGGG + Intergenic
995556657 5:113336757-113336779 ACAGATACTTACAGCAGCCATGG - Intronic
997378943 5:133421439-133421461 AAGTATACAGACAGCAGGCAGGG - Intronic
1001387894 5:171354967-171354989 CAGTTTACTTTCAGCTGCCACGG - Intergenic
1001523212 5:172410073-172410095 AGCTCTAGTCACAGCAGCCAAGG - Intronic
1007262141 6:40571453-40571475 CAGACAACTTGCAGCAGCCAAGG + Intronic
1013451801 6:110288893-110288915 CAGTCTCCTTTCTGCAGCCAAGG - Intronic
1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG + Intergenic
1017661460 6:156678220-156678242 AACTTAACTTCCAGCAGCCAAGG + Intergenic
1019325282 7:435167-435189 AAATCAACTCACGGCAGCCAGGG - Intergenic
1023720782 7:43091663-43091685 AACTGTAGTGACAGCAGCCATGG - Intergenic
1026444920 7:70475742-70475764 AAGTCTACTAATAGCGGCCAGGG + Intronic
1028216853 7:88143583-88143605 AAGTCTTCTTAAAGCAGAAATGG + Intronic
1028572264 7:92303676-92303698 AAGTGTGATTACAGAAGCCAAGG + Intronic
1030583338 7:111386600-111386622 AAGTAAAGTTACAGCAGACAAGG + Intronic
1033149181 7:138898349-138898371 GAAACTACTGACAGCAGCCAGGG + Intronic
1034030613 7:147758878-147758900 AATTTTACTTCTAGCAGCCATGG + Intronic
1037580223 8:20240875-20240897 AAGGTTACTTAGACCAGCCATGG - Intergenic
1045611604 8:103849192-103849214 CAGTCCACTTACAGCAGTGATGG + Intronic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1052448497 9:28594641-28594663 TTGTGTAATTACAGCAGCCAAGG + Intronic
1053466341 9:38311436-38311458 AAGGCTGCTCACAGGAGCCAGGG - Intergenic
1056926345 9:90837969-90837991 AAGACTCCTGAAAGCAGCCAGGG + Intronic
1057039224 9:91835323-91835345 ATGTCTCCTTAAAGAAGCCACGG - Intronic
1059108697 9:111534314-111534336 GAGACTTCTTCCAGCAGCCATGG - Exonic
1062090015 9:134670998-134671020 ACGTCTCCTCACAGCAGCCCAGG - Intronic
1062098730 9:134716813-134716835 AAGTCTACTCACAACAGCTCTGG - Intronic
1203361088 Un_KI270442v1:219697-219719 AAATCTAGTGCCAGCAGCCACGG - Intergenic
1185845569 X:3434582-3434604 GTGTCTACATAAAGCAGCCAGGG + Intergenic
1185845649 X:3435339-3435361 ATGTCTACATAAAGCAGGCAGGG + Intergenic
1185895652 X:3856283-3856305 ATGTGTAATTACAACAGCCATGG + Intergenic
1185900771 X:3894707-3894729 ATGTGTAATTACAACAGCCATGG + Intergenic
1185905886 X:3933146-3933168 ATGTGTAATTACAACAGCCATGG + Intergenic
1186111435 X:6261167-6261189 AAGTCTACCCACTACAGCCAAGG - Intergenic
1191044572 X:56121681-56121703 AAGGCTACTTGCCACAGCCAGGG + Intergenic
1193347403 X:80420542-80420564 AAGTCTACTATCAGAAGACACGG + Intronic
1195871560 X:109491749-109491771 CAGTCTACATACCACAGCCAAGG + Intergenic
1198115592 X:133542043-133542065 TCTTCCACTTACAGCAGCCAAGG + Intronic