ID: 1117791023

View in Genome Browser
Species Human (GRCh38)
Location 14:59342511-59342533
Sequence TACTATGCACAAAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117791020_1117791023 -2 Left 1117791020 14:59342490-59342512 CCTTTTTTGTTGGCAATTTATTA 0: 1
1: 0
2: 6
3: 45
4: 497
Right 1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 167
1117791018_1117791023 25 Left 1117791018 14:59342463-59342485 CCAATCAGCAGTTTACTTTTCAT 0: 1
1: 0
2: 6
3: 34
4: 301
Right 1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117791023 Original CRISPR TACTATGCACAAAAGGAGCT GGG Intronic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
905525846 1:38638933-38638955 TACTTTGAACTAAAGGAGATTGG + Intergenic
905721908 1:40210975-40210997 TACTATTCACAACAGGGGGTTGG + Intronic
906597769 1:47094618-47094640 TACTACTCAGAAAAGGCGCTGGG + Exonic
908093752 1:60715224-60715246 TAGTAAGCACAATAGGAGCCTGG + Intergenic
908912439 1:69087825-69087847 TACTTTGAACTAAAGGAGATGGG + Intergenic
909746144 1:79099524-79099546 TACTATGAACAAATGCATCTGGG - Intergenic
909994797 1:82266047-82266069 TACTTTGAACTAAAGGAGATTGG - Intergenic
913295974 1:117320851-117320873 TACTTTGAACTAAAGGAGATTGG + Intergenic
913959619 1:143328288-143328310 AACTAGGCACAAAAGGAGCAAGG - Intergenic
914053978 1:144153861-144153883 AACTAGGCACAAAAGGAGCAAGG - Intergenic
914125168 1:144812504-144812526 AACTAGGCACAAAAGGAGCAAGG + Intergenic
919873980 1:201847736-201847758 GACTAGGCAGAAAAGGAGATTGG + Intronic
920234945 1:204496650-204496672 TGCTGTGCACAAATGGAACTGGG + Intergenic
921332988 1:214058532-214058554 TAGTATGAAGAAAAGGAACTTGG + Intergenic
923233917 1:232013983-232014005 TACTTTGAACCAAAGGAGATTGG - Intronic
1063868060 10:10388635-10388657 CACTATACACCAAAGGAGGTAGG - Intergenic
1067022309 10:42812152-42812174 AACTAGGCAGAAAAGGAGCAAGG - Intronic
1070049657 10:72875797-72875819 TATTATGTGGAAAAGGAGCTGGG + Intronic
1072576434 10:96704808-96704830 TAATGTGCACAGAAGGACCTGGG - Intronic
1074038792 10:109767521-109767543 TGATATGCCCAAAAGGAGCAAGG + Intergenic
1079765139 11:24382649-24382671 TACTTTACACAGAAGGAGTTGGG - Intergenic
1084839400 11:71832352-71832374 TACTATGCAGAAAATCAACTGGG - Intergenic
1086132073 11:83411233-83411255 TACTAAGTATATAAGGAGCTGGG + Intergenic
1087902979 11:103663620-103663642 TACTTTGAACAAAAGGAGATTGG + Intergenic
1087924018 11:103898908-103898930 TGTTAGGCACAAAAGGTGCTGGG + Intergenic
1092399603 12:8163245-8163267 TACTATGCAGAAAATCAACTGGG + Intronic
1093128655 12:15361941-15361963 TACTGTGCACAAAATTAGCCTGG - Intronic
1093464584 12:19436911-19436933 TACTTTGAACTAAAGGAGATTGG + Intronic
1097386236 12:58952821-58952843 TATAATGTAGAAAAGGAGCTAGG + Intergenic
1097889770 12:64765849-64765871 TACAATACACAAAATTAGCTGGG + Intergenic
1100721689 12:97365827-97365849 TATAATGAAGAAAAGGAGCTTGG + Intergenic
1102114468 12:110391929-110391951 TAAAATGCAAAAAAGTAGCTGGG + Intronic
1104691823 12:130832318-130832340 TATTAGGCACAATAGGAGCCTGG - Intronic
1105950513 13:25225584-25225606 GTCTTAGCACAAAAGGAGCTGGG - Intergenic
1106341834 13:28837126-28837148 TACAATGAAGAACAGGAGCTAGG - Intronic
1108011381 13:46016451-46016473 TACTGTTAACAAAAGAAGCTAGG + Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1110571295 13:77007600-77007622 TACTATTCAGAAGAGTAGCTGGG - Exonic
1111403877 13:87776829-87776851 TAATATGAACAAAAGCAGATGGG - Intergenic
1112121868 13:96421485-96421507 TACCATGCTCAGGAGGAGCTTGG - Intronic
1114538457 14:23437587-23437609 TAAGATGCACAAAGGGTGCTTGG + Intergenic
1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG + Intronic
1119542514 14:75450079-75450101 TACTATGGACAAGGGGAGTTGGG + Intronic
1119879952 14:78092135-78092157 TACAAAGCACATAAGCAGCTAGG - Intergenic
1120280340 14:82430827-82430849 TACTTTGAACTAAAGGAGATGGG + Intergenic
1120573363 14:86149491-86149513 CACTGTGCACAAAATGAGCTAGG - Intergenic
1120662805 14:87270716-87270738 TACTTTGCACTGAAGGAGATGGG + Intergenic
1123423425 15:20149045-20149067 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1123532646 15:21155566-21155588 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1127235385 15:57045219-57045241 TCCTTTTCACAAAAGGAACTGGG + Intronic
1128578274 15:68790881-68790903 TACTTTGAACTAAAGGAGATTGG + Intronic
1128953860 15:71918733-71918755 TACTATGGAGAAAAAGACCTTGG + Intronic
1131707949 15:95019007-95019029 TTCTATTTACAAAAGGAGATTGG + Intergenic
1133718872 16:8475392-8475414 TATTATGCACACAGGGAGTTGGG - Intergenic
1135851147 16:25965116-25965138 TTCTATGAAGAAAAGGAGCTCGG + Intronic
1136861396 16:33706561-33706583 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1141449088 16:84085133-84085155 TCCTATGAATAAAAGCAGCTTGG + Exonic
1203122895 16_KI270728v1_random:1554752-1554774 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1142744584 17:1949448-1949470 AACAATGCAAAACAGGAGCTGGG + Intronic
1143022329 17:3923240-3923262 TAAAATGCATAAAAGGGGCTGGG + Intergenic
1144327734 17:14197834-14197856 TCCTGTGCACAGAAGCAGCTGGG - Intronic
1147891226 17:43718692-43718714 TACAATGCACAAAGGGAGCCTGG - Intergenic
1149351619 17:55794114-55794136 TATGATGCAAAAAAGGAGGTTGG - Intronic
1150146305 17:62772453-62772475 TACAATGCACAAAAGGAAAAAGG + Intronic
1150376124 17:64683226-64683248 TTAAATGCACAAAAGGAGATTGG + Intergenic
1150484571 17:65534767-65534789 AACAATACAAAAAAGGAGCTGGG + Intronic
1151140532 17:71987504-71987526 TACTATGCACAAAACAATTTTGG + Intergenic
1153898232 18:9589056-9589078 TACTGTGAACAACAGAAGCTTGG - Intronic
1155096668 18:22562580-22562602 GACTACCCACAAAAGTAGCTGGG + Intergenic
1155728556 18:29121787-29121809 TACTATCCACAAAATGAGTTTGG + Intergenic
1155940498 18:31797703-31797725 TACTTTGAACTAAAGGAGATTGG - Intergenic
1156339153 18:36195850-36195872 GACTATGGACAAAAGGTGCCTGG + Intronic
1157093434 18:44663119-44663141 GACTATGCACTAAAGGAGCATGG - Intergenic
1159796972 18:72855616-72855638 TACTATGAACAGCAAGAGCTTGG + Intronic
1163047209 19:14652413-14652435 TAATATGCACAAAAGGAAATAGG - Intronic
1164411818 19:28012551-28012573 TACAATGCACAGAGGGAGCGGGG - Intergenic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1166576834 19:43849052-43849074 TCCTATGCACATAAGGAATTTGG + Exonic
1167448211 19:49551595-49551617 TCAAATGCAAAAAAGGAGCTGGG - Intergenic
1202693457 1_KI270712v1_random:106541-106563 AACTAGGCACAAAAGGAGCAAGG - Intergenic
929461406 2:42104325-42104347 TACTTTGAACTAAAGGAGATTGG - Intergenic
930829042 2:55723955-55723977 TACTCTACTCAAAAGGAGTTGGG + Intergenic
930854240 2:55995400-55995422 TACTAAGCACACAATGTGCTTGG - Intergenic
931448465 2:62347273-62347295 TACTTTGAACTAAAAGAGCTTGG - Intergenic
933953115 2:87348041-87348063 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934237346 2:90244386-90244408 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934459771 2:94207680-94207702 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
935738431 2:106125494-106125516 TCCTGTGCACAAGAGGAGCATGG + Intronic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
937343989 2:121111675-121111697 TAAGATGGACAAAAGAAGCTAGG + Intergenic
937719896 2:125081838-125081860 TACTAATCACAAAATGAGTTAGG + Intergenic
938111047 2:128565284-128565306 AACTATGCAGAAAAGAAGGTGGG - Intergenic
938937261 2:136137972-136137994 TACTTTGAACTAAAGGAGATTGG - Intergenic
943328784 2:186533913-186533935 TACTATGTACAAAGAGAGCATGG - Intergenic
945099039 2:206247028-206247050 TTATATGCACTAAAGAAGCTGGG + Intergenic
946798744 2:223386294-223386316 TACTATGTACAAAATGAGTGAGG + Intergenic
1172175060 20:32967090-32967112 TGCTAGGCACAAAAAGTGCTGGG - Intergenic
1174243120 20:49154173-49154195 TACTTTACATAAAAGGACCTGGG + Intronic
1177979187 21:27889412-27889434 TACTTTGAACTAAAGGAGATTGG + Intergenic
1178458847 21:32782316-32782338 TACTTTGAACTAAAGGAGATTGG - Intergenic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1180116675 21:45711050-45711072 TACTATACACAAAATGAGCCTGG - Intronic
1181356428 22:22298776-22298798 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1183187792 22:36302249-36302271 TATTATACACAAAAGCAGCCCGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
951132360 3:19062780-19062802 TACTATACAGGAAAAGAGCTTGG + Intergenic
952376054 3:32768284-32768306 TACTATCCACAAAATGGGCCGGG + Intronic
952413674 3:33071627-33071649 TACTTTGAACTAAAGGAGATCGG + Intronic
953760532 3:45683401-45683423 TGCCATGCAGAAAAGGGGCTGGG - Exonic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
957156118 3:76547039-76547061 TTCAATGCACAAAAGCAGTTAGG + Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
963200247 3:142578852-142578874 TCCTATGCAGAAAAGACGCTGGG - Intergenic
964073853 3:152669008-152669030 TACTATGTACAATATGAGCCTGG - Intergenic
964810827 3:160662594-160662616 CACCATGCACAAAATTAGCTTGG + Intergenic
969780483 4:9398358-9398380 TACTATGCAGAAAATCAACTGGG - Intergenic
970977969 4:22062968-22062990 GGCAATGCACAAAAGGAGCATGG + Intergenic
973142354 4:46784111-46784133 TGCTATTCACAAAAGGAACTGGG - Intronic
975192463 4:71481172-71481194 CACTATGCTCAGAAGGTGCTGGG + Intronic
975736438 4:77385748-77385770 TACTTTGCACTAAAAGAGATAGG + Intronic
976261451 4:83148790-83148812 TGCTCTGCACAAGAGGTGCTGGG + Intergenic
976366237 4:84235472-84235494 TACTTTGCACAATAGGATGTAGG - Intergenic
980708594 4:136533854-136533876 GCCTATGCACAAAAAGATCTGGG + Intergenic
981032418 4:140138712-140138734 AACTGGGCACAAAAGGAGCCAGG + Intronic
981706236 4:147662205-147662227 AACTAAACACAAAAGAAGCTAGG + Intronic
981734588 4:147935808-147935830 AACCTTGCACAAAAGCAGCTTGG - Intronic
981977056 4:150743483-150743505 TATTATGAACAATATGAGCTTGG + Intronic
986154431 5:5160042-5160064 TACTAAGCCAAAAAGAAGCTAGG + Intronic
987605463 5:20129477-20129499 TACTATGCACCAGAGATGCTGGG + Intronic
987785912 5:22498225-22498247 TGCTATGCAGAAAATTAGCTGGG - Intronic
989034864 5:37160035-37160057 TATTATGCATAAAAGGTGATAGG + Intronic
991065777 5:62423450-62423472 TACTATGCAGAACAGTAGCATGG + Intronic
995809368 5:116087055-116087077 TACTATGTACAAAATCATCTGGG - Intronic
996505125 5:124259916-124259938 TACTTTGAACTAAAGGAGATTGG - Intergenic
999401260 5:151266034-151266056 TCCTATGCAGAAAAGGATTTTGG + Intronic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1001899579 5:175414821-175414843 TACTATGAAAAAAAGGAGGAAGG - Intergenic
1004213962 6:13684068-13684090 TACTATGCACAGCAAGTGCTAGG + Intronic
1004248240 6:14001122-14001144 CCCAATGCACTAAAGGAGCTTGG - Intergenic
1006587153 6:35123024-35123046 TACTCTGCAAAAACGGAGCTGGG + Intronic
1008552006 6:52641797-52641819 TACTATTCACAAGAGCACCTTGG + Intergenic
1009226229 6:61022615-61022637 TACTATTCATAAATGGTGCTGGG - Intergenic
1010142232 6:72624080-72624102 TACAATGCACACAAGGAGAACGG + Intronic
1010165306 6:72907560-72907582 TACTATAAGTAAAAGGAGCTTGG + Intronic
1010246528 6:73664458-73664480 TACTTTGAACTAAAGGAGATTGG - Intergenic
1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG + Intergenic
1011991443 6:93523789-93523811 TGCTATGAACAGAAGGAGTTAGG - Intergenic
1014637796 6:123870235-123870257 TACTATGGAGAAAAGCAGCCTGG + Intronic
1014755701 6:125300199-125300221 TACTATCCATAAAAGGCACTAGG + Intronic
1021269613 7:18569417-18569439 AACTATGCAGAACAGGAGTTAGG - Intronic
1021710304 7:23409822-23409844 TACTATTCATAAAATGAGATTGG + Intronic
1022691166 7:32656571-32656593 TATTCTGCAGAAAAGTAGCTTGG - Intergenic
1022918727 7:34990477-34990499 TATTCTGCAGAAAAGTAGCTTGG - Intronic
1029046610 7:97635806-97635828 TACTCAGCACAAAAAGAGCTAGG - Intergenic
1029837782 7:103331251-103331273 AATTATGCACAAAATGAGCCAGG - Intronic
1029978650 7:104857850-104857872 AACTATGCACAAGAGCAGCGGGG + Intronic
1030836408 7:114292673-114292695 TACTATGCAGAAAAAGTCCTAGG - Intronic
1031305649 7:120123247-120123269 TCTTATGCAGAAAAGGGGCTGGG - Intergenic
1032984882 7:137326903-137326925 TGCAATGCACACAATGAGCTGGG - Intronic
1036277913 8:7372298-7372320 TACTATGCAGAAAATCAACTGGG - Intronic
1036389936 8:8316679-8316701 TAATATGCAGAAGAGGACCTGGG + Intergenic
1036756002 8:11471538-11471560 TACTAATCACCAGAGGAGCTGGG - Intronic
1036838955 8:12100363-12100385 TACTATGCAGAAAATCAACTGGG + Intergenic
1036860744 8:12346606-12346628 TACTATGCAGAAAATCAACTGGG + Intergenic
1039537377 8:38329488-38329510 TACGATGCACAAAGGGAGCCTGG - Exonic
1042443315 8:68852984-68853006 TACTTTGAACTAAAGGAGATTGG - Intergenic
1044226097 8:89720049-89720071 TATTATTCAGAAAAGGAACTAGG + Intergenic
1045428914 8:102095164-102095186 TACTATGGTCAAATGGAGCTGGG + Intronic
1045526894 8:102948565-102948587 CACTAAGCTCATAAGGAGCTAGG - Intronic
1047374198 8:124280796-124280818 TAATATTCACAAAAGCTGCTGGG + Intergenic
1048813387 8:138308791-138308813 GACTGTGGACAACAGGAGCTTGG - Intronic
1048918303 8:139204761-139204783 ACCTCTGCACAAAATGAGCTGGG + Intergenic
1050847814 9:10245487-10245509 TACTATGTACAAAATGTGCAAGG + Intronic
1053690274 9:40583493-40583515 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1053851423 9:42291593-42291615 TACTTTGAACTAAAGGAGATTGG - Intergenic
1054301525 9:63384454-63384476 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1056394510 9:86169174-86169196 CAATAAGCCCAAAAGGAGCTAGG + Intergenic
1057496334 9:95564275-95564297 TAGTGTGGCCAAAAGGAGCTGGG - Intergenic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1188370009 X:29358251-29358273 TACTTTGAACCAAAGGAGATTGG - Intronic
1189462824 X:41255787-41255809 TACTATGCACTATAGCAGCTGGG + Intergenic
1189606365 X:42682255-42682277 TACTTTGAACTAAAGGAGATTGG - Intergenic
1192988666 X:76427984-76428006 TACTGCGCACAACAGCAGCTGGG + Exonic
1197101700 X:122663547-122663569 TACTTTGAACTAAAGGAGATTGG - Intergenic
1197169879 X:123420411-123420433 TTCTAAGCACAAAAGGAACAGGG - Intronic
1201461608 Y:14231773-14231795 TACTAAGCATACAAGGAGATGGG - Intergenic