ID: 1117802639

View in Genome Browser
Species Human (GRCh38)
Location 14:59461082-59461104
Sequence AAGCCACAAGGTCCTTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117802635_1117802639 24 Left 1117802635 14:59461035-59461057 CCTTTTCTTTTCCACAAGTAAAC 0: 1
1: 0
2: 1
3: 33
4: 384
Right 1117802639 14:59461082-59461104 AAGCCACAAGGTCCTTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 141
1117802637_1117802639 13 Left 1117802637 14:59461046-59461068 CCACAAGTAAACTTGTTATGGCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1117802639 14:59461082-59461104 AAGCCACAAGGTCCTTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117802639 Original CRISPR AAGCCACAAGGTCCTTGCTG AGG Exonic
900556897 1:3285128-3285150 GAGTCCCAAGGTCCTTGGTGAGG + Intronic
901068796 1:6507199-6507221 AAGCCACAATGACCCTGCTGGGG - Intronic
902756420 1:18552288-18552310 TAGGCACAAGGTCCTTGGGGAGG - Intergenic
902846027 1:19111315-19111337 AAGCCCCAAAGTCCTTACAGAGG + Intronic
903018087 1:20374828-20374850 AAGCCACATGGTGCCTGCTGTGG + Intergenic
903398234 1:23019343-23019365 AAGCTACACGTTCTTTGCTGCGG + Intergenic
904868193 1:33599133-33599155 GAGACACAAGGCCCTTGCTATGG - Intronic
908459643 1:64336945-64336967 AAGGCCCTAGGTCCTTGCTAAGG + Intergenic
912952227 1:114127957-114127979 AAGCCACCGGGTCCTTGGTAGGG - Intronic
917122577 1:171657091-171657113 ATGCCTCAGGGTCCCTGCTGAGG + Intergenic
919256290 1:195128841-195128863 AAGCCACAAGGTCCTGGACTCGG + Intergenic
920882530 1:209893892-209893914 AAGCCAAAAGGACCTTGCCTTGG + Intergenic
922351748 1:224739738-224739760 AGGCCACAAGGTGCTTGCTAAGG + Exonic
923231046 1:231986720-231986742 AAGTGACAGGCTCCTTGCTGTGG - Intronic
924094767 1:240539862-240539884 AAGCCACAAGGTCTCAGATGTGG - Intronic
924677374 1:246193498-246193520 AGGCCACAAGGCCACTGCTGGGG - Intronic
1067548711 10:47217596-47217618 AAGGCACAAAGTCCATGCTCAGG + Intergenic
1068141675 10:53016558-53016580 AAGCAACAATGTCATTACTGAGG - Intergenic
1069814435 10:71184700-71184722 AAGCCACAGGGAACTTGGTGAGG - Intergenic
1070409189 10:76123763-76123785 AAGGCACAGGATCCTGGCTGAGG + Intronic
1070518168 10:77227066-77227088 ATGCCACAAGCTCCATGCTATGG - Intronic
1074599293 10:114897405-114897427 AAGTCAAAATGGCCTTGCTGAGG + Intronic
1074775144 10:116762440-116762462 AAGTCACAATGGCCATGCTGTGG + Intergenic
1075861769 10:125683285-125683307 GAGCCACCAGGTCCCAGCTGAGG + Intergenic
1076036817 10:127205555-127205577 AAGCCACATGGTGTTTGCTGTGG - Intronic
1076140719 10:128076997-128077019 AAGCCACAGGGGCCTCTCTGGGG + Intronic
1076827868 10:132978934-132978956 AAGCCAGATGGGCCTGGCTGAGG + Intergenic
1076909625 10:133380408-133380430 GGGCCACCAGGTCCATGCTGTGG - Exonic
1079906995 11:26260840-26260862 AAGCCTGAAGGTTCTTGGTGGGG + Intergenic
1079985133 11:27192226-27192248 ATGCCACAAAGGCCATGCTGTGG + Intergenic
1081868210 11:46371336-46371358 TGGCCACAATCTCCTTGCTGTGG - Exonic
1082632587 11:55559576-55559598 GAGTCACAAGGTGCTTGGTGGGG - Intergenic
1083788631 11:64969804-64969826 AAGTCACCAGGTCATTACTGAGG - Intronic
1084593370 11:70103295-70103317 GAGCCACATGGTCTTTGCAGGGG - Intronic
1087992463 11:104762110-104762132 AAAACTCAAGGTCCTTGTTGAGG - Intergenic
1088079952 11:105900075-105900097 AACACACAAGGTCCCAGCTGTGG - Intronic
1095102952 12:38202287-38202309 ATGCCCCAAGGTCATCGCTGTGG + Intergenic
1095173289 12:39060476-39060498 GAGTCACAAGGTGCTTGTTGGGG - Intergenic
1096088648 12:48883554-48883576 AAGCTTCAGGGGCCTTGCTGGGG + Intergenic
1099326025 12:81215326-81215348 AAGCCATATGGTCACTGCTGAGG - Intronic
1102795687 12:115687254-115687276 CAGCCACAAGGTCATTACTCAGG - Intergenic
1103318646 12:120077299-120077321 AAGGAACAAAGTCCTTCCTGTGG + Intronic
1104735718 12:131135040-131135062 AAGGCAGAAGGTCCCTGCTGTGG + Intronic
1105734615 13:23255058-23255080 AAGCCCCAAAGTCCCTACTGGGG + Intronic
1107787186 13:43969017-43969039 TGGCCACAATCTCCTTGCTGTGG - Intergenic
1108450704 13:50559831-50559853 AAGCCACAAAGGCCCTGTTGGGG - Intronic
1109576264 13:64263479-64263501 AAGCAGCAAGGTCCTGGGTGTGG - Intergenic
1113981103 13:114276726-114276748 AATGCACAGGGTCCTCGCTGAGG + Intergenic
1117802639 14:59461082-59461104 AAGCCACAAGGTCCTTGCTGAGG + Exonic
1118890478 14:69904119-69904141 AAGCCACAAGGTCTTGGGGGTGG + Intronic
1119729438 14:76941764-76941786 AAGCCACTTGGTCCCAGCTGCGG - Intergenic
1121446847 14:93984148-93984170 AAGCCCCTGGATCCTTGCTGGGG - Intergenic
1121744141 14:96274837-96274859 AAGCCACAAGGCATTGGCTGGGG - Intergenic
1122248376 14:100420263-100420285 AAACCAAAAGTTACTTGCTGTGG - Intronic
1126066061 15:44827360-44827382 AAGCCATAAGGTCCTTTCCTGGG - Intergenic
1126093774 15:45073204-45073226 AAGCCATAAGGTCCTTTCCTGGG + Intronic
1132009485 15:98263158-98263180 AAGACATAATGTCCTTCCTGTGG - Intergenic
1138492088 16:57382726-57382748 AAGCCACTGGCTCCCTGCTGGGG - Exonic
1139464018 16:67144430-67144452 AAGCCAAAAGCTCTTTCCTGGGG - Intronic
1140909438 16:79438161-79438183 AAGCTACAAGGCCCTTTGTGGGG + Intergenic
1141303701 16:82841043-82841065 AAGGCAAATGGTACTTGCTGGGG + Intronic
1141596391 16:85099567-85099589 AGGCCACACGGTCCCTGCCGTGG - Intronic
1143772177 17:9175733-9175755 AACCCACGCGGTCCTTGCTCTGG - Intronic
1144438065 17:15258981-15259003 AAGCCAGAATGTCGTTGCTGGGG - Intronic
1144864001 17:18323366-18323388 AAGCCACCAGTCCCTTGGTGGGG + Intergenic
1148794065 17:50188850-50188872 AGGCCACAATGGCCATGCTGAGG + Intronic
1150315903 17:64168590-64168612 AAGCCACAGGGGCCTGGTTGTGG + Intronic
1151522592 17:74641069-74641091 CAGCCACATCTTCCTTGCTGGGG + Intergenic
1154141269 18:11826474-11826496 AAAACCCAAGTTCCTTGCTGTGG - Intronic
1156201500 18:34837598-34837620 AAGCCACATGATCTTGGCTGTGG - Intronic
1159423858 18:68258430-68258452 AAGCCACAAGGCCCATCCAGAGG + Intergenic
1162152367 19:8655496-8655518 AAGCCACAAGCTTCAGGCTGGGG + Intergenic
1168000703 19:53443760-53443782 AAGCCACAAGGGGTTTGTTGGGG + Intronic
931626524 2:64261143-64261165 AATCCACACGGTCAATGCTGGGG + Intergenic
932605957 2:73165894-73165916 AAGGAACAAGGACCCTGCTGTGG + Intergenic
933926468 2:87094556-87094578 AAGGAACAAGGACCCTGCTGTGG - Intergenic
935475916 2:103523910-103523932 AAGCCAAAAGGTGCTGTCTGTGG + Intergenic
935667048 2:105521885-105521907 AAGCCACAAGTCCCTTCATGGGG + Intergenic
939171009 2:138695427-138695449 AAGACACCAGGTGCTTGCTTGGG + Intronic
940191167 2:151041553-151041575 AAGCCATAAGTTCCTCTCTGTGG + Intronic
940642665 2:156362926-156362948 AAGACACAAAGTCCTTGCCCTGG - Intergenic
940859718 2:158759175-158759197 AAGCCACCAGGTCCATCATGGGG - Intergenic
941206009 2:162573874-162573896 ATGCCACAATGTCCTTGCATAGG - Intronic
942828533 2:180210263-180210285 AAGACAGAAGGTGCTTGTTGGGG + Intergenic
948510524 2:238461246-238461268 CAGCAACAAAGTCCTGGCTGGGG + Intergenic
948854501 2:240723844-240723866 AAGCCACAAGGTGAGTGCTTGGG + Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1170902302 20:20476812-20476834 TAGCCACAAGGTCCATCCAGAGG + Intronic
1173802954 20:45906297-45906319 AAGCCACAGGATCCTTCATGAGG + Exonic
1174102510 20:48138318-48138340 AGGCCACAAGGGCCATGCTGTGG - Intergenic
1176385532 21:6137140-6137162 AAGCCCCAAGGTTGTTTCTGGGG - Intergenic
1179737941 21:43401112-43401134 AAGCCCCAAGGTTGTTTCTGGGG + Intergenic
1181593145 22:23896762-23896784 AGGCCACAGGGCCCTTGCAGGGG - Intronic
1182556738 22:31133417-31133439 AAGCCACATAGTCCTTGCAATGG - Exonic
1182853192 22:33494194-33494216 AAGCCAAAAAGCCCTGGCTGTGG + Intronic
1183745454 22:39689125-39689147 AACCCACATGGGCCTGGCTGTGG + Exonic
1184948452 22:47821463-47821485 AAGCCACCAGGTCCATGATGGGG + Intergenic
950520439 3:13494842-13494864 AAGCCATGAGGCCCCTGCTGGGG + Intronic
952350362 3:32529982-32530004 AAGCCACAACGTCCTCCCTAAGG + Intronic
952857431 3:37783898-37783920 AAACCACAAAGACCTTCCTGGGG - Intronic
953179314 3:40581767-40581789 CAGCCTCAAGGCCCTTGCTTGGG + Intergenic
960639250 3:119810852-119810874 AAGCTATGAGGTCCTTGGTGGGG - Intronic
961501173 3:127337156-127337178 GAGCCCCAGGGTGCTTGCTGTGG - Intergenic
961553357 3:127681224-127681246 GGGCCACAAGGTCCTCCCTGGGG - Intergenic
963008394 3:140747822-140747844 AAGGAACATTGTCCTTGCTGGGG - Intergenic
963497252 3:146081512-146081534 AAGGAACAAGCTCATTGCTGTGG - Intronic
965458149 3:168929761-168929783 GGGCCACAGAGTCCTTGCTGGGG - Intergenic
966911771 3:184563888-184563910 GGGCCACAAGGCCCTTGTTGTGG + Intronic
968468405 4:764671-764693 CAGGCACAAGCTCCTTGCAGTGG - Intronic
972823005 4:42723816-42723838 AAGCCAAAATGTCCCAGCTGAGG + Intergenic
974395102 4:61323671-61323693 AAGCAATAAGGTCCAGGCTGAGG - Intronic
985519649 5:367565-367587 ATGCCACGTGGGCCTTGCTGGGG + Intronic
989389822 5:40888381-40888403 ACTCCACATGCTCCTTGCTGAGG - Intergenic
990134892 5:52633218-52633240 AAGCAAGAAGGTCTTTGATGAGG + Intergenic
995901758 5:117077562-117077584 AAGTCCCAGGGTCCTTGCTATGG + Intergenic
997200025 5:132004302-132004324 AGGGCACAAGGTCTGTGCTGTGG - Intronic
997210228 5:132072902-132072924 AAGCCTGGAGGGCCTTGCTGGGG + Intergenic
997830537 5:137145979-137146001 GAGCCACAGGGACCATGCTGGGG + Intronic
998263367 5:140648077-140648099 AAGCCACAGGGTCCTAAGTGAGG + Intronic
998535873 5:142930276-142930298 AAGCCACAGGGTCAGTTCTGTGG + Intronic
998871676 5:146558646-146558668 AAGCCACTAGGTCCATAATGGGG - Intergenic
1000330842 5:160204158-160204180 TACCCACAGGGTTCTTGCTGTGG + Intronic
1001523594 5:172413196-172413218 AAGCCACAAGGTCCTGGGGCAGG + Intronic
1006452935 6:34115510-34115532 CAGCCACAAGGTCCTGGTTCAGG + Intronic
1007317384 6:41000257-41000279 AAGCCCCAAGCTCCTGTCTGGGG - Intergenic
1007407193 6:41641903-41641925 AACCCACAGAGTCCTTGCTGAGG + Intronic
1007510425 6:42370666-42370688 AAGCCAGGAGGGCCTGGCTGGGG - Intronic
1007704636 6:43783331-43783353 AAGCCACAAGAACATTGCTGGGG - Intronic
1011252504 6:85387588-85387610 AAGACACATGGATCTTGCTGGGG + Intergenic
1019613199 7:1947232-1947254 TATCCTCAAGGTCCCTGCTGGGG + Intronic
1022392510 7:29955800-29955822 AACCCAAAGGGTCCTTGCAGGGG - Intronic
1022890121 7:34688635-34688657 CAGCCACAAGGTCTTTGCATGGG - Intronic
1024153859 7:46600351-46600373 AAGCCAAGTGATCCTTGCTGAGG + Intergenic
1026195397 7:68168956-68168978 AAGGCATATGGTCGTTGCTGGGG - Intergenic
1028910414 7:96201618-96201640 AATTAACAAGGTCCTTGCTTAGG - Intronic
1034653072 7:152707571-152707593 AAGTCAAAAGTTCCTTGCTTGGG - Intergenic
1034990188 7:155543070-155543092 ATGCCACAGGGTCCTTGGAGAGG - Intergenic
1041513109 8:58672700-58672722 AAGCCTCAATGTCCTAGGTGTGG - Intergenic
1045593091 8:103621185-103621207 AAGTAACAATGGCCTTGCTGAGG - Intronic
1046672701 8:117074259-117074281 AAGCCTCATGGCCCTTCCTGTGG + Intronic
1049716674 8:144096169-144096191 AGGCCACGAAGTCCATGCTGTGG - Exonic
1050465281 9:5916057-5916079 AAGCCTCAAGCACCATGCTGTGG + Intronic
1050587568 9:7128849-7128871 GAGCCCCAAGGTGTTTGCTGAGG - Intergenic
1052345092 9:27401273-27401295 AAGTCACAGGGTCCAGGCTGAGG - Intronic
1052581276 9:30358015-30358037 AAGCCACCAGGTACATTCTGAGG - Intergenic
1054881340 9:70148049-70148071 AAGCCAAAGGGTCCCTGCAGAGG - Intronic
1056424980 9:86466910-86466932 AAGCCACAAACTGCTTGCTGTGG + Intergenic
1057998502 9:99842214-99842236 AAGCAACTAGGTGCTTACTGTGG - Intronic
1059483193 9:114608019-114608041 AATCCACAAGGTCCTTGTGGTGG - Intergenic
1061964452 9:134005124-134005146 AAGCCAGCAGGTCCCTCCTGGGG - Intergenic
1188036344 X:25321615-25321637 AAGACACAAGGGCCTATCTGAGG - Intergenic
1190637876 X:52454384-52454406 AAGACACTTGGTCCTTGTTGTGG + Intergenic
1190639886 X:52474163-52474185 AAGACACTTGGTCCTTGCTGTGG + Intergenic
1190647786 X:52538702-52538724 AAGACACTTGGTCCTTGCTGTGG - Intergenic
1190678775 X:52806079-52806101 AAGACACGTGGTCCTTGCTGTGG - Intergenic
1193199166 X:78667349-78667371 AAACCAAGAGGTCCATGCTGGGG - Intergenic
1200212318 X:154352217-154352239 AGCCCACAAGGTCCGAGCTGGGG - Exonic
1202258848 Y:22948461-22948483 AAGCCAGATGGTCCTTTCTGGGG + Intergenic
1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG + Intergenic
1202458946 Y:25087853-25087875 AAGCCAGATGGTCCTTTCTGGGG - Intergenic