ID: 1117805877

View in Genome Browser
Species Human (GRCh38)
Location 14:59490216-59490238
Sequence GTTTAAAAGATCCTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 2, 2: 6, 3: 26, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117805877 Original CRISPR GTTTAAAAGATCCTGGTGGC TGG (reversed) Intronic