ID: 1117809577

View in Genome Browser
Species Human (GRCh38)
Location 14:59532578-59532600
Sequence TTCTGGCCTTCCCTTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117809570_1117809577 20 Left 1117809570 14:59532535-59532557 CCTGAGTTTCAGCTGAGCACATG 0: 1
1: 1
2: 9
3: 30
4: 229
Right 1117809577 14:59532578-59532600 TTCTGGCCTTCCCTTGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117809577 Original CRISPR TTCTGGCCTTCCCTTGTGGG TGG Intronic
900130209 1:1084196-1084218 CCCTGGCCCTGCCTTGTGGGTGG + Intronic
900939859 1:5791751-5791773 TTCTGGCTTTTCCATGTGGAAGG + Intergenic
901178909 1:7326242-7326264 TTCTGGCCCTCCCTTGTATTTGG - Intronic
902503252 1:16924249-16924271 TTCTTGCCCTCCCTGTTGGGGGG + Intronic
903182849 1:21613768-21613790 TTCTGGCCTTACTTTGTGGGGGG - Intronic
903886250 1:26542695-26542717 TTCTGGGCTGCCATTGTGGGTGG + Intronic
903957139 1:27033310-27033332 TTCTCCCCTTCCCTGCTGGGCGG - Intergenic
905756052 1:40509749-40509771 TTCTGGCCTTCCCTATGAGGAGG + Exonic
907282828 1:53362194-53362216 TTCTGCCCTTTCTTTGTGGGAGG - Intergenic
907362990 1:53935604-53935626 TTCTGGCCTTTTTTTGGGGGTGG - Intronic
909615777 1:77606417-77606439 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
910384544 1:86666488-86666510 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
910712916 1:90200250-90200272 TTCTTGCCTTTCTTTGTGGTTGG - Intergenic
912117039 1:106419404-106419426 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
912871663 1:113312019-113312041 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
915321242 1:155057544-155057566 TTCTGGTCTTGGCCTGTGGGAGG + Intronic
917534454 1:175864282-175864304 TTCTGGCCTCCCCTCCTGGAGGG - Intergenic
918786435 1:188769554-188769576 TTCTGGCCACCCCTGTTGGGAGG - Intergenic
919028495 1:192207794-192207816 TACTGGCCTTCCCATTTGGTAGG + Intergenic
919455978 1:197819490-197819512 TTCTGTTCTTCCCTTAAGGGTGG - Intergenic
920879006 1:209863052-209863074 TTCTTCCCATCCCCTGTGGGTGG + Intergenic
921419411 1:214929099-214929121 TTATGGCCTTACCTTCTGAGAGG + Intergenic
924118664 1:240773899-240773921 CTCTGGCCTTCCCTTGAAGCAGG + Intergenic
1063934929 10:11067528-11067550 TACTGTCCTTGCCTTGTGTGTGG - Intronic
1064927612 10:20586622-20586644 TTCTGGCTCTGCCTTTTGGGAGG + Intergenic
1065360865 10:24887771-24887793 TTCTGGCCTACAGTTGTGGTGGG - Intronic
1069248884 10:66244323-66244345 TTATGTCCTTCCCTTCCGGGTGG - Intronic
1069566244 10:69465208-69465230 CTCTGGGCTTCCCCTGGGGGTGG + Intronic
1070525026 10:77288895-77288917 TTCTTGCCTGGCCTTGTGGATGG - Intronic
1070559021 10:77551925-77551947 TTCTGGCCTTCCAGTGGGGCTGG - Intronic
1071896654 10:90075573-90075595 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1072039890 10:91596930-91596952 TACTTGCCTTCCCCTGTTGGAGG - Intergenic
1072361509 10:94663933-94663955 TTCTGGAGATCCCTTTTGGGAGG + Intergenic
1072784591 10:98270943-98270965 TTCTGGCCTTCCCACTTGGGAGG - Intergenic
1074038121 10:109761506-109761528 TTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1074051469 10:109884576-109884598 TGCCTGGCTTCCCTTGTGGGAGG - Intronic
1074827268 10:117223589-117223611 TCCTGGCCTTCTGTGGTGGGTGG + Intergenic
1076335697 10:129705002-129705024 TGCTTGCCTTCCATTGTTGGGGG - Intronic
1076425852 10:130367133-130367155 ATGAGGTCTTCCCTTGTGGGTGG + Intergenic
1076588576 10:131568015-131568037 TTCTGGGTTTCTGTTGTGGGAGG - Intergenic
1077836030 11:5929018-5929040 GACTGGCCTTCCCTTGAGGAAGG - Intronic
1081646045 11:44791450-44791472 TTCTAGCCTTCACATGTCGGGGG - Intronic
1081674677 11:44961890-44961912 TTCTGGCCTGCACCCGTGGGTGG + Intergenic
1081984684 11:47293037-47293059 TTCTGCCATACCATTGTGGGTGG + Intronic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1086027754 11:82315003-82315025 CTGTGGCCTTCCATTATGGGTGG - Intergenic
1086182894 11:83976430-83976452 ATTTGTCCTTCCTTTGTGGGAGG + Intronic
1086743045 11:90391659-90391681 TTCTGGGCTTCCCTGGGGGTCGG - Intergenic
1086800552 11:91169670-91169692 TTCTGGCAACCCCTTTTGGGAGG - Intergenic
1087720898 11:101664675-101664697 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
1088181906 11:107121965-107121987 TTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1088994861 11:114987441-114987463 TTCTGGCCTTTCCTTGGAGAGGG - Intergenic
1089121117 11:116136060-116136082 TTCTGACCTTCCCTTGAAGTAGG + Intergenic
1089124401 11:116166262-116166284 TTCTGGACTTCCCTTGGGGACGG + Intergenic
1089395725 11:118135572-118135594 TTCTAGCCTGCCCTAGGGGGAGG - Exonic
1091933024 12:4412486-4412508 TTCTCTCCTTCCCTTGTGGAGGG + Intergenic
1094258805 12:28467081-28467103 CTCTGGCCTTTCTTTGTGTGTGG - Intronic
1097030082 12:56083594-56083616 TTCTGCCTATCGCTTGTGGGAGG + Intronic
1097119064 12:56718386-56718408 TGCTGGACTTCCTTTGGGGGAGG + Intronic
1097119087 12:56718458-56718480 TGCTGGACTTCCTTTGGGGGAGG + Intronic
1098342533 12:69467590-69467612 TTCTGACATTCCAGTGTGGGTGG + Intergenic
1098886196 12:75963108-75963130 TTCTGCCTTTCCCTTCTGGCTGG - Intergenic
1100904991 12:99286978-99287000 TTATGCCCTTCCCTTCAGGGTGG - Intronic
1101499363 12:105288193-105288215 TTCTTGCCCTCCCTTGCAGGTGG + Intronic
1102318034 12:111905547-111905569 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1106471958 13:30064111-30064133 TTCTGACCTTCCCCTGAGGCAGG - Intergenic
1107718745 13:43226656-43226678 TCCTGCCCATCACTTGTGGGAGG - Intronic
1109100632 13:58180436-58180458 TTCTCTCCTTCCCTTCAGGGTGG + Intergenic
1110567693 13:76972631-76972653 TTCAAGCCTTCCCCTGTGGGAGG - Intergenic
1113862918 13:113501771-113501793 TGCTGTCCTTGCCTTGTGGCTGG + Exonic
1114627039 14:24136592-24136614 TTCTGGCCTTTCCCTCAGGGAGG + Intronic
1115795679 14:36932769-36932791 TTCCTGCCTTCCCTTCTCGGGGG - Intronic
1116766033 14:49071140-49071162 TTGTGCCCTTCCCTTTAGGGTGG - Intergenic
1117809577 14:59532578-59532600 TTCTGGCCTTCCCTTGTGGGTGG + Intronic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1119430828 14:74567174-74567196 TTCAGGGCTGCCCTTGAGGGGGG - Intronic
1121349302 14:93160826-93160848 TTCTGGGCATCAGTTGTGGGTGG - Intergenic
1121780209 14:96617470-96617492 TTCTGGATTTCCATTTTGGGTGG + Intergenic
1121993585 14:98584497-98584519 TCCTGGCCTTCCTCTGTGTGTGG - Intergenic
1122687858 14:103518524-103518546 TGCTGGGCTTGGCTTGTGGGGGG - Intergenic
1125272371 15:37953141-37953163 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1126852695 15:52806568-52806590 ATCTGGCCTTCTCTAGAGGGAGG - Intergenic
1128900970 15:71422756-71422778 TTGTGTCCTTCCCTTTAGGGTGG + Intronic
1129501146 15:76038687-76038709 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
1130159055 15:81380843-81380865 TGCTAGCCTTGCCTTGCGGGTGG + Intergenic
1131048120 15:89328974-89328996 TTCTGGCCTTGCTTTGTGGGGGG + Exonic
1132591014 16:726500-726522 GTCTGGCCGGCCCCTGTGGGCGG - Intronic
1132949511 16:2553008-2553030 TCCCCGCCTTCCCTTGGGGGTGG + Intronic
1132964837 16:2647158-2647180 TCCCCGCCTTCCCTTGGGGGTGG - Intergenic
1138243843 16:55451517-55451539 CTTAGGCCTTCCCTGGTGGGAGG - Intronic
1140276500 16:73513549-73513571 TTGTGGGCTGCCCTTGAGGGAGG - Intergenic
1141466184 16:84207243-84207265 TGCTGGTCTGCCCTTCTGGGAGG - Intergenic
1141610651 16:85179223-85179245 TTCTGGTCGTCTCTTGTGAGTGG + Intronic
1141716400 16:85729509-85729531 CTCTGAGCTTCCCCTGTGGGGGG - Intronic
1141987167 16:87587648-87587670 TTCAGACCTTCCCATGTGTGGGG + Intergenic
1142615270 17:1130604-1130626 ATCTGGACATACCTTGTGGGGGG - Intronic
1149184311 17:53979308-53979330 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1149540648 17:57465648-57465670 TGCTGGCCTTCCCTTTTCAGAGG + Intronic
1151101885 17:71565232-71565254 TTCTAGGCTTCCTTGGTGGGAGG + Intergenic
1151707020 17:75774499-75774521 TTCTAGCCTTACCTTGGAGGAGG + Intergenic
1153018636 18:606855-606877 AACTGGCCTTGCCTTGTGGGGGG - Intronic
1153256266 18:3174647-3174669 TGCTGTCCTGCCCTTGTGGTGGG + Intronic
1153309900 18:3667761-3667783 CTCTGGCCTAGCCTTGGGGGTGG - Intronic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155436213 18:25815677-25815699 TCCTGGCCTTGCCTTGCAGGGGG - Intergenic
1157212388 18:45754726-45754748 TTCTGGCTTTCCCATTCGGGTGG - Intergenic
1157339586 18:46767535-46767557 TTCTGACCTTTCCTTGTGGCTGG - Intergenic
1158521375 18:58174198-58174220 TTCTCTCCTTCCCGTGTGGCTGG + Intronic
1158622640 18:59046422-59046444 TTCTGCCCTTCCCTGGAGGAGGG - Intergenic
1158948930 18:62474276-62474298 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1159497138 18:69221329-69221351 TTCTGGCCTGGCTCTGTGGGTGG + Intergenic
1161928722 19:7321380-7321402 TTTTGGCCTTGCCTGGCGGGTGG - Intergenic
1162111762 19:8403502-8403524 TTCTGTCCGTCCGTGGTGGGCGG - Exonic
1164618236 19:29679130-29679152 TTCTGGCCTGCCCCTGTGGGTGG - Intergenic
1164749029 19:30637380-30637402 TTCTGTCCATCCCCTGTGGAAGG + Intronic
1164919878 19:32081344-32081366 TTCTGGACATCCCTAATGGGTGG - Intergenic
1165443512 19:35844237-35844259 TTCTGGCCTTCCCCAGCGGGCGG - Exonic
1166202849 19:41249804-41249826 TTCTGGTATTCCCTTGGTGGTGG - Intronic
925588559 2:5487510-5487532 TTCAGGCCTTAGCTTCTGGGTGG + Intergenic
926549522 2:14284767-14284789 TACTGTCCTTCCTTTGAGGGAGG - Intergenic
926929800 2:18025214-18025236 TTCTGGCTTGTCCTGGTGGGAGG + Intronic
928715458 2:34055465-34055487 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
929760897 2:44805532-44805554 TCCTGGCCCTCCTTTGGGGGGGG - Intergenic
930649877 2:53953919-53953941 TTTTGTTCTTCCCCTGTGGGAGG - Intronic
932494093 2:72138085-72138107 TGCTGGCCTTCTCATTTGGGCGG - Intronic
932714679 2:74092754-74092776 TTCTGGCCTTTCCTTCAGGAGGG - Intronic
933560333 2:83878728-83878750 GACTGGCCTTCCCTTGAGGAAGG + Intergenic
934969844 2:98754488-98754510 GTCTGTCCTTCCCTTGAGGCAGG - Intergenic
935147006 2:100402483-100402505 AGCTGGCCTTCCCCTGTGGCTGG - Intronic
935478528 2:103556585-103556607 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
937213337 2:120292510-120292532 TTCTTCCCTTCCCTGGTGGTTGG + Intronic
937394845 2:121525765-121525787 TTCTGGTGTTCCGTAGTGGGTGG - Intronic
938091073 2:128435177-128435199 TTCTGACCTTCCCCTGAGGTAGG + Intergenic
938199498 2:129361684-129361706 TTCTGGGCTTCCTGGGTGGGAGG - Intergenic
938649013 2:133361626-133361648 TTTTGGCCTTTTCTTGTGGCAGG - Intronic
939244731 2:139609415-139609437 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
940638179 2:156322333-156322355 TGCTGGCCTTCCGCTGTGGATGG - Intergenic
941745881 2:169087044-169087066 TTGTGTCCTTCCCTTCGGGGTGG + Intronic
943831833 2:192473123-192473145 TTCTATCCTTCCCTTCTGGCTGG - Intergenic
944511512 2:200470596-200470618 TTCCCACCTCCCCTTGTGGGTGG - Intronic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
946769046 2:223069460-223069482 TTTGGGCCTTCCATGGTGGGTGG + Intronic
947002702 2:225475356-225475378 TTCTACCCTCCCCTGGTGGGAGG + Intronic
948774752 2:240278294-240278316 TTGTGTCCTTCCCTTATGGGTGG - Intergenic
948897905 2:240935728-240935750 TGCTGGCCTCCCCGTGGGGGTGG + Intronic
948981972 2:241499044-241499066 TGCTGGCCCTCCAGTGTGGGTGG + Exonic
1169628692 20:7600824-7600846 TTGTGTCCTTCCCTTTAGGGTGG - Intergenic
1169984677 20:11430666-11430688 TTCTGGCCTTTCCTCCAGGGAGG + Intergenic
1170311555 20:14997678-14997700 TTCTGTCTTTCCCTTCAGGGTGG - Intronic
1172857904 20:38022069-38022091 TTCTGGCCTTTGCTTGTGACAGG - Intronic
1175937921 20:62523456-62523478 TTCTAGCCAGTCCTTGTGGGAGG + Intergenic
1175993548 20:62801891-62801913 TTCTGGGCTTCCCTGTGGGGAGG + Intergenic
1176087802 20:63305956-63305978 GTCTGGGCTCCCCGTGTGGGAGG - Exonic
1179187518 21:39096327-39096349 CACTGTCCTTCCCTGGTGGGTGG - Intergenic
1179453436 21:41481033-41481055 TTGTGGCCTCCCTTTGTGTGCGG - Intronic
1179994715 21:44968581-44968603 CTCTGCCCTTCCCCTGTGGCTGG + Intronic
1181287072 22:21760109-21760131 TTCAGACCTTCACCTGTGGGGGG - Exonic
1181320144 22:21998174-21998196 TTCTGACCTTCCCCTGTAGTAGG + Intergenic
1181377864 22:22474829-22474851 ATCTGGCTTTGCCCTGTGGGAGG - Intergenic
1182085752 22:27560168-27560190 GTCTAGCCTTTCCATGTGGGTGG + Intergenic
1182245282 22:28952311-28952333 CTCTGGCCCTCCCTTCTGGACGG + Intronic
1182348032 22:29680553-29680575 TTCTGGCCATGCCTTGTAGTTGG + Intronic
949829172 3:8196385-8196407 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
949906695 3:8864004-8864026 TTTTGGCCTCCCCTTCTGTGGGG + Intronic
950110956 3:10418454-10418476 TTCTGCTCTTCCCATGTGTGGGG + Intronic
950555546 3:13693654-13693676 TTTTGGCCTTCCCTGGAGGTTGG - Intergenic
954880325 3:53831337-53831359 TTGTGGCCTTCCCTTTGGGGCGG - Intronic
956613860 3:71151923-71151945 TTATGGCCTTCCCTTGAGTATGG + Intronic
959891939 3:111566779-111566801 TTGTGTCATTCCTTTGTGGGAGG + Intronic
960109241 3:113829170-113829192 TTCTGGCCTTCCCTCGTGCTGGG - Intronic
962459117 3:135592230-135592252 TTGTGGCCTGTACTTGTGGGTGG - Intergenic
964295100 3:155225109-155225131 GTCTGGCCTTCCCTGTTGGGGGG + Intergenic
964349894 3:155791906-155791928 TTGTGTCCTTCTCTTCTGGGTGG - Intronic
965059929 3:163772759-163772781 TTGTGTCCTTCCCTTCTGGGTGG + Intergenic
970958460 4:21843498-21843520 TTCTGACCTTCCCTTGAAGTGGG + Intronic
972666255 4:41167927-41167949 TTCTGTCCTGACCTTGTGGTAGG - Intronic
976375726 4:84342782-84342804 TTCTGGCTGTCCCTTGGTGGAGG - Intergenic
978008570 4:103651122-103651144 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
979073388 4:116240578-116240600 TTATGTCCTTCCCTTCAGGGAGG + Intergenic
979167751 4:117558057-117558079 TTTTGGCCTTTGCTTCTGGGAGG + Intergenic
979525781 4:121715069-121715091 TTCTAGCTTTCCCGTGTGGCAGG + Intergenic
983017307 4:162628922-162628944 TTTTGTCCTTCCCTTTAGGGTGG - Intergenic
985696452 5:1343588-1343610 TTCTGGCCTCCCCTTCATGGAGG + Intronic
985697487 5:1348996-1349018 TGCTGCCCTTTCCTAGTGGGGGG + Intergenic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986868309 5:12015818-12015840 TTCCTGCCTTCCCTTGTGCGTGG - Intergenic
987645946 5:20672464-20672486 TTGTGCCTTTCCCTTCTGGGTGG - Intergenic
989378982 5:40795601-40795623 TGCTGGCCTTCCCTGCTGGAAGG + Intronic
989681319 5:44032621-44032643 CTGTGTCCTTCCCTTCTGGGTGG - Intergenic
990260590 5:54017657-54017679 TTCTAGCCTTCCCTTTGGGAGGG - Intronic
991209063 5:64083976-64083998 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
992291459 5:75283834-75283856 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
996116332 5:119624201-119624223 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
996925529 5:128822024-128822046 TTCTGGCATGCCCTGGTTGGAGG - Intronic
999544042 5:152607086-152607108 ATCTCCCCTTCCCTTGTAGGGGG - Intergenic
1002321907 5:178381330-178381352 TGCTGGCCTTCCCCTGTGGAAGG - Intronic
1003952242 6:11127203-11127225 TTCTGTCCTTCCCATTAGGGTGG + Intronic
1004062376 6:12210166-12210188 TTCAGTCCTTACCCTGTGGGAGG + Intergenic
1004402673 6:15303472-15303494 TCCTGGCCTTCCCTCTTTGGTGG + Intronic
1006602426 6:35235004-35235026 TTCTGGCCATCCCTGGTAAGAGG + Intronic
1007304925 6:40896412-40896434 TCCTGACCATCCCCTGTGGGTGG - Intergenic
1007317426 6:41000472-41000494 TCCTGGGCTTCCCTTTTAGGAGG - Intergenic
1008031458 6:46699444-46699466 TTCTGGCCCTGCCCTGAGGGTGG - Intronic
1008314781 6:50026323-50026345 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1009301700 6:62031810-62031832 CTGTGTCCTTCCCTTCTGGGTGG - Intronic
1011271168 6:85580928-85580950 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1011386204 6:86801457-86801479 TTGTGTCTTTCCCTTGAGGGTGG + Intergenic
1013235611 6:108195465-108195487 GGCTGACCTTCCCTTCTGGGAGG + Intergenic
1013288448 6:108699786-108699808 GTCAGGCCTTCACTGGTGGGCGG - Intergenic
1017387456 6:153902115-153902137 TTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1019076509 6:169392792-169392814 CTCTGTCCTCCCTTTGTGGGTGG - Intergenic
1019580793 7:1761213-1761235 TTCGGTCCTTCCCCTGTTGGTGG - Intergenic
1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG + Intronic
1022383318 7:29880931-29880953 TTCTGGCCTACCTTTCTTGGTGG + Intronic
1022896663 7:34756864-34756886 TTCAGGGCCTCCCTTGTGGCTGG + Intronic
1025806685 7:64839523-64839545 GACTGGCCTTCCCTTGAGGAAGG + Intergenic
1026827506 7:73593736-73593758 CTCTGCCCTTCCCTGGGGGGTGG - Exonic
1026943547 7:74302469-74302491 TTCTGGCCAGGCCTGGTGGGAGG - Intronic
1029271854 7:99381808-99381830 TTCTGCCTTTCCCTTGTGCCTGG + Intronic
1030601211 7:111595269-111595291 TTCTGACCTTCCCTTGAAGCAGG + Intergenic
1034590694 7:152136522-152136544 TTTTGTTTTTCCCTTGTGGGTGG - Exonic
1037143075 8:15540582-15540604 CCTTGGCCTTCCCCTGTGGGCGG + Intronic
1037654723 8:20873078-20873100 TTATGGCCTTCCCAATTGGGAGG + Intergenic
1038292885 8:26265750-26265772 TTCTGAGCTTCCCTTTTGGAAGG - Intergenic
1039026777 8:33267268-33267290 TTCTGACCTTCCCTTGAAGCAGG + Intergenic
1040595271 8:48832217-48832239 TTGTGGCCTTCCTTGCTGGGTGG + Intergenic
1040747388 8:50662024-50662046 TTCTGGCCTTCTCCTGTGTCAGG + Intronic
1042882712 8:73511656-73511678 TTCCGCCCCTCCCATGTGGGTGG + Intronic
1045207175 8:100055082-100055104 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1045487245 8:102641015-102641037 CTCTCTCCTTGCCTTGTGGGTGG - Intergenic
1045567267 8:103333160-103333182 TTCTAGCCTTCTGTTTTGGGAGG - Intergenic
1048681098 8:136842721-136842743 TCCTTGTCTTCCCTTGTTGGAGG - Intergenic
1049050052 8:140187662-140187684 TCCTGGCCTTTCCCTGTTGGTGG + Intronic
1049205524 8:141361828-141361850 TTCTGGCCCACCCTTCCGGGTGG + Intronic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1052359915 9:27542691-27542713 TTCTGGCATTTGCTTGTGGGTGG - Intergenic
1054804854 9:69387902-69387924 ATCTGGCTTTACCTTGGGGGTGG + Intronic
1056329476 9:85509927-85509949 TTATAGCCTACCCATGTGGGTGG - Intergenic
1056844083 9:90022508-90022530 TTCTGCCCTTGGCTTGTAGGTGG - Intergenic
1057544148 9:96004553-96004575 TGCTGGCCTTTCTTTGTGTGTGG - Intronic
1058445411 9:105050601-105050623 TTCTGGCCTTTCCTTTGGGTTGG + Intergenic
1059839173 9:118192440-118192462 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1061278167 9:129581494-129581516 CTCTGGACCTCCCTTCTGGGGGG + Intergenic
1061935562 9:133855647-133855669 TTTTGGTCTTCCCATGTGCGGGG - Intronic
1061943940 9:133898042-133898064 TCGTGGCCTTCCCTGGTAGGAGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062513124 9:136918687-136918709 TTTTCACCTTCCCCTGTGGGTGG + Intronic
1185948210 X:4401517-4401539 TTCTCTCCTCCCCTTGTGGCTGG - Intergenic
1187314903 X:18183937-18183959 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1188022045 X:25169883-25169905 TTCTGGCCTTCCCCTGGGACTGG + Intergenic
1188972221 X:36632370-36632392 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1189191835 X:39115968-39115990 TTCTGTTCTTGCCTTGTGGTAGG + Intergenic
1189874269 X:45419926-45419948 TTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1191654111 X:63577263-63577285 TTCAGCCTTGCCCTTGTGGGAGG - Intergenic
1192809733 X:74537350-74537372 TTCTGCGCTTGCCTAGTGGGGGG + Intergenic
1192891001 X:75390291-75390313 TTCTGTTCTTCCCTTCTGGGTGG - Intronic
1194990793 X:100544382-100544404 ATGTGGCCTTCCCTTCAGGGTGG - Intergenic
1195595533 X:106683917-106683939 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1196053590 X:111331598-111331620 TTATTGCCATCCCTTATGGGGGG + Intronic
1196096665 X:111808196-111808218 TTGTGTCTTTCCCTTCTGGGTGG + Intronic
1196555295 X:117078256-117078278 GTCTGTCCTTCCCTTGAGGCGGG + Intergenic
1196619688 X:117807555-117807577 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1199041180 X:143116842-143116864 TTATGTGCTTCCCCTGTGGGCGG + Intergenic
1199148379 X:144397934-144397956 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1201770011 Y:17610340-17610362 GACTGGCCTTCCCTTGAGGAAGG - Intergenic
1201831543 Y:18295647-18295669 GACTGGCCTTCCCTTGAGGAAGG + Intergenic
1202063456 Y:20912547-20912569 TTTTGTCCTTCCCTTGAGGCAGG - Intergenic