ID: 1117814560

View in Genome Browser
Species Human (GRCh38)
Location 14:59583467-59583489
Sequence CCTCCCTTTTCCCACCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117814560_1117814564 27 Left 1117814560 14:59583467-59583489 CCTTGAAGGTGGGAAAAGGGAGG No data
Right 1117814564 14:59583517-59583539 GCAATTCCCTATGAGAAGTGCGG No data
1117814560_1117814562 3 Left 1117814560 14:59583467-59583489 CCTTGAAGGTGGGAAAAGGGAGG No data
Right 1117814562 14:59583493-59583515 TTGAAGCACACTTGAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117814560 Original CRISPR CCTCCCTTTTCCCACCTTCA AGG (reversed) Intergenic
No off target data available for this crispr