ID: 1117816419

View in Genome Browser
Species Human (GRCh38)
Location 14:59603525-59603547
Sequence GGATGGATTCATTTTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117816419 Original CRISPR GGATGGATTCATTTTCATCT TGG (reversed) Intronic
900725014 1:4210462-4210484 GGATGGGAGCATTTGCATCTAGG + Intergenic
901120893 1:6892705-6892727 GGTTGGTTTCATTTTCAACTAGG + Intronic
901729488 1:11268621-11268643 GGACGGTTTCATTTCCATCTTGG + Intergenic
902200059 1:14826677-14826699 GGCTGGATTTTTTTTCATCTCGG + Intronic
902567606 1:17322752-17322774 GGTAAGATTCATTTTCTTCTAGG + Intronic
902898125 1:19493666-19493688 GGATGGATTTATTCTCACTTTGG + Intergenic
906882972 1:49612888-49612910 AGAAGGATTCATTTTCCTTTGGG - Intronic
907502571 1:54892571-54892593 AGATTGATTCATTGACATCTTGG - Intergenic
907760523 1:57354313-57354335 GGATTGATTGATTTTTATCTTGG - Intronic
909047366 1:70727211-70727233 GTATGGATTCTTTCTCATTTTGG + Intergenic
909918530 1:81351406-81351428 GGATTGACTTATTTTCATCACGG - Intronic
911934232 1:103947040-103947062 GGATGGATGCATTTTTATCCTGG - Intergenic
913239542 1:116818025-116818047 TGGAGGATTCATCTTCATCTGGG - Intergenic
918927858 1:190810507-190810529 GTGTGGGTTCTTTTTCATCTTGG - Intergenic
920797141 1:209150403-209150425 ATATGCATTCATTTTCATTTTGG + Intergenic
922292419 1:224219479-224219501 GGCTGGATTAATTTGCATTTTGG + Intergenic
923202065 1:231722513-231722535 AGAGGTATTCATTTTCTTCTTGG + Intronic
924886683 1:248225838-248225860 GTTTGCATTCATTTTCATCAAGG + Intergenic
1062823726 10:553249-553271 GGCTGAATTCATGTTCACCTGGG + Intronic
1064421844 10:15197569-15197591 GAATAGCATCATTTTCATCTCGG + Intergenic
1066185951 10:33010637-33010659 GGATGGATTCATTTTCCATCTGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073007184 10:100333462-100333484 GGAAGGGTTCTTTTTCATTTGGG + Intergenic
1073425631 10:103453953-103453975 CTAAGGATTCATTTTGATCTTGG - Exonic
1078470349 11:11581316-11581338 TGACAGATTCATTTTCATCCGGG + Intronic
1082860555 11:57851642-57851664 GGATGAAGCCAATTTCATCTTGG - Intergenic
1085249655 11:75134596-75134618 GAGTGAATTCATTTTCAACTTGG - Intronic
1085559004 11:77453005-77453027 GCATGGATGAATTTACATCTGGG - Intronic
1086348762 11:85924090-85924112 GGATAGATTCTTTTTTCTCTGGG + Intergenic
1086842861 11:91709513-91709535 AGATGGATTTCTTTTCATCATGG - Intergenic
1087866874 11:103240184-103240206 AGATGGATTCATTCTCAGATGGG + Intronic
1091872338 12:3904398-3904420 GTATGGCTTCATTATCTTCTCGG + Intergenic
1091889742 12:4044108-4044130 GGATGAATTCTTGTTAATCTGGG + Intergenic
1092183330 12:6461079-6461101 GACTGGTTTCATTTTCATTTAGG - Intronic
1092484862 12:8893703-8893725 GGATGGATTCTTATGCATTTAGG - Intergenic
1092952537 12:13520566-13520588 TCATGGATTCAGTTTCTTCTTGG + Intergenic
1093283101 12:17220778-17220800 AGTTGGATTCTTATTCATCTTGG - Intergenic
1093542274 12:20301224-20301246 GGATGGATTCAGTTTATTCTAGG - Intergenic
1094738494 12:33261423-33261445 GGATAGCTTCCTTTGCATCTGGG + Intergenic
1095635471 12:44428363-44428385 GGAAGAAATTATTTTCATCTGGG + Intergenic
1097899638 12:64859698-64859720 GGATGGGTTCATTTTCAGATAGG + Intronic
1098362093 12:69664860-69664882 TGATGGTTTCCTTTTCATTTTGG - Intronic
1099171474 12:79369914-79369936 GAATGGAATCTTTTTTATCTTGG + Intronic
1099290620 12:80772196-80772218 GTATTGATTTATTTTCATTTGGG + Intergenic
1099978944 12:89576582-89576604 TGGGGGATTCTTTTTCATCTTGG + Intergenic
1101967128 12:109289289-109289311 GCATTGATTCATTTACATATTGG + Intronic
1102909238 12:116699879-116699901 GGATGTAATTAATTTCATCTGGG + Intergenic
1105671785 13:22626727-22626749 GCATGTATTCATTTTATTCTGGG - Intergenic
1106318956 13:28620566-28620588 GGCTGAATTCTTCTTCATCTTGG + Intergenic
1106603016 13:31203306-31203328 GGATGGATTCTTTGTCATCCAGG + Intronic
1107089085 13:36457046-36457068 GGCTTGAATTATTTTCATCTGGG - Intergenic
1107712744 13:43166765-43166787 GGATGGGCTCATCTTCCTCTGGG + Intergenic
1108526770 13:51292201-51292223 GTATGGATCCAGTTGCATCTTGG + Intergenic
1109274669 13:60290536-60290558 GGATGGCTCCATTTTCCTCATGG + Intergenic
1109451958 13:62527853-62527875 GGATGTTTTCATTTTGACCTAGG + Intergenic
1109641730 13:65200578-65200600 GAATGGATGCATTTTTTTCTTGG + Intergenic
1109651861 13:65337300-65337322 GCATGGATTCTCTTTCACCTGGG - Intergenic
1110680007 13:78298828-78298850 TGATGGTTTCATTTTCAAATTGG + Intergenic
1112500112 13:99936400-99936422 GGATGGAATCTTATTCCTCTTGG + Intergenic
1114357861 14:21933174-21933196 GGATTGTTTCATTTGGATCTAGG + Intergenic
1115938936 14:38587341-38587363 GCAGGGATTCAATTTCTTCTTGG + Intergenic
1116421740 14:44740833-44740855 GGATGGATTAATTTTTTTTTTGG - Intergenic
1116669846 14:47827619-47827641 GCATTGAATCATTTTCATATAGG - Intergenic
1117353898 14:54905313-54905335 TAAGGGATTCATTTTCAGCTTGG + Intergenic
1117816419 14:59603525-59603547 GGATGGATTCATTTTCATCTTGG - Intronic
1122713152 14:103675547-103675569 AGATGGGTTTATTTTCATCTAGG - Exonic
1125165998 15:36705361-36705383 GGAAAAATTTATTTTCATCTTGG - Intronic
1125222520 15:37355618-37355640 AGATGGCCTCATTTTCAACTGGG + Intergenic
1125471716 15:40010958-40010980 GGAGGGAGTCATTTTGCTCTGGG - Intronic
1127200722 15:56647017-56647039 GTATGTTTTCAGTTTCATCTTGG - Intronic
1127896363 15:63303208-63303230 GAATGTTTTGATTTTCATCTAGG - Intronic
1127896500 15:63304301-63304323 GAATGTTTTGATTTTCATCTAGG + Intronic
1128239713 15:66093683-66093705 AGGAGGATTCATCTTCATCTGGG + Intronic
1132731158 16:1362664-1362686 GGGTGGGTTCATTTTCTTCTGGG - Exonic
1133180019 16:4047223-4047245 GCATGGAGCCATTTTCATCCAGG + Intronic
1133508877 16:6439048-6439070 GGCTAGATTGATTTTCAACTGGG - Intronic
1134654649 16:15939021-15939043 TGATGGCTTCATTTGCATCCTGG - Intergenic
1135291106 16:21239264-21239286 GGAAGGATTCATATTCCTTTGGG - Intronic
1135867351 16:26116136-26116158 GGCAGGATTCAGTTTCATTTGGG + Intronic
1136135822 16:28256328-28256350 GCATGCATTCATTTTCAAATTGG - Intergenic
1137563006 16:49515084-49515106 GGAAGGATTCATTCTCGTCACGG - Intronic
1138717856 16:59044816-59044838 GGTTGGATTGATATTCATCATGG - Intergenic
1140627004 16:76805815-76805837 AGATGGTTTCATTTTCATCAGGG - Intergenic
1141262315 16:82464932-82464954 TGATGGTTTTATTTTCATCTTGG + Intergenic
1144455120 17:15412455-15412477 GTATGGATCCATCTTCATCACGG + Intergenic
1151196009 17:72431516-72431538 GGCTGGATTCATTGTTATCTAGG - Intergenic
1155967855 18:32052738-32052760 GGATCGAATCCTTTGCATCTTGG + Intronic
1156058915 18:33048727-33048749 GGATAGCTTCATTTTTATCAAGG + Intronic
1157205028 18:45690788-45690810 GGATTGTTTTAATTTCATCTTGG + Intergenic
1158828443 18:61251263-61251285 GGATGGATTTCTCTTTATCTGGG - Intergenic
1159157019 18:64597305-64597327 AGAAGGATTTATTTTCATTTTGG + Intergenic
1159194013 18:65087757-65087779 GGATGAATCCAGTTTCATTTTGG + Intergenic
1160516367 18:79481295-79481317 AGCTGGAGTCATTTTCATCCAGG - Intronic
1162077398 19:8196928-8196950 GAATGGATTCATTGTCATATTGG - Intronic
1164395134 19:27856462-27856484 GGATGAAATCAACTTCATCTTGG - Intergenic
1164500778 19:28818300-28818322 GGATGGATTCATCTTCTTTGCGG - Intergenic
1165438704 19:35811789-35811811 GGATGGAATCAGGGTCATCTGGG - Intronic
1166486144 19:43214551-43214573 TGCTGGAGTCATTTTCCTCTGGG + Intronic
925814958 2:7738337-7738359 TGATGGCTTCATTTCCATCCTGG - Intergenic
926421637 2:12705413-12705435 TGATGGTTTCATTTTCTCCTTGG - Intergenic
928208483 2:29305111-29305133 TGAGGGGTCCATTTTCATCTTGG + Intronic
928942873 2:36744293-36744315 GGAAGGATTTATTTTCCTTTTGG + Intronic
930254059 2:49068691-49068713 TATTGGTTTCATTTTCATCTTGG - Intronic
930703251 2:54480729-54480751 GACTGAATTCTTTTTCATCTTGG - Intronic
932315541 2:70779463-70779485 GGATGAATTCATTAGCACCTTGG - Intronic
933164637 2:79062702-79062724 GGAAGGATTCATTTCCTCCTGGG - Intergenic
935236526 2:101143517-101143539 GTATGGAATCATTTACATCAAGG + Intronic
935955228 2:108369692-108369714 TCATGGATTCATTTTAAACTTGG - Intergenic
937609024 2:123838466-123838488 GGATGAATCCATCTTCATCATGG - Intergenic
939714597 2:145568516-145568538 GGATGTATGAAGTTTCATCTTGG + Intergenic
940600421 2:155852026-155852048 GGATGGATTATTTTTCAACAAGG - Intergenic
941704761 2:168646024-168646046 GGAATGATTCATATTCCTCTGGG + Intronic
941764299 2:169279853-169279875 TGATGGGTTTAATTTCATCTTGG - Intronic
942082357 2:172412677-172412699 TAATGCATTCATTTTCATATAGG + Intergenic
946649562 2:221876154-221876176 AGAATGATTCATTTTCCTCTGGG + Intergenic
947144908 2:227055654-227055676 GGAAGGGTGCATTTTCATTTTGG - Intronic
947387859 2:229609975-229609997 GGATGGATTGATTTTTCTCATGG - Intronic
948015929 2:234690557-234690579 GGGGGGGTTCATTTTCTTCTGGG - Intergenic
948195129 2:236090003-236090025 CGATGGATTCATTTGCAGCCAGG - Intronic
948585615 2:239016995-239017017 GGATGGATCCATTTGCATTCAGG + Intergenic
1169672720 20:8121263-8121285 AGATGGATTTATCTTCATTTTGG - Intergenic
1170175901 20:13469613-13469635 TGGTGGATGCATTTTTATCTTGG - Intronic
1174760928 20:53206776-53206798 GGAAAGATTCATTTTCTTGTGGG + Intronic
1177890740 21:26800939-26800961 GAATGGATTCATTTTTATACAGG + Intergenic
1179366130 21:40759846-40759868 CGATGGCTGCATTTTCATCTGGG - Intronic
1181828298 22:25537795-25537817 GGATTGATTCATTTTCCTTTGGG - Intergenic
1182921587 22:34085108-34085130 GGATGGATTCAAGTACATTTTGG - Intergenic
1184341004 22:43885884-43885906 AAATGAGTTCATTTTCATCTGGG + Intronic
1184599424 22:45533756-45533778 TGATGCATTCATTGACATCTAGG - Exonic
1184626487 22:45736033-45736055 GGATAGATTAATTTTCTTTTAGG + Intronic
1185161142 22:49230487-49230509 AGAGGGATTCCTGTTCATCTCGG - Intergenic
1185412330 22:50690103-50690125 GGATCAATTCATTTTCAACAAGG - Intergenic
950944658 3:16932509-16932531 GGAGGTATTTATTTTCATCTTGG + Intronic
951268583 3:20598668-20598690 TCATGGATTCAATTTCTTCTTGG + Intergenic
955041912 3:55325723-55325745 GGAGGGTATCATTTTCATCTTGG - Intergenic
955318806 3:57959840-57959862 GGGAGGAACCATTTTCATCTTGG - Intergenic
956362544 3:68464488-68464510 TTATGGACTCATTTTCACCTTGG - Intronic
961405485 3:126676830-126676852 GGATGGACTCACTTTCTTCTTGG - Intergenic
962065321 3:131973685-131973707 GAATGGATACATTTTGATGTGGG - Intronic
963463876 3:145652851-145652873 GCATGGCTTCCTTTTTATCTTGG - Intergenic
963765096 3:149326442-149326464 GGATAGGTACATTTTCCTCTTGG + Intronic
964218857 3:154321661-154321683 GAATGCATTCATTTTCAGCCAGG + Intronic
964649293 3:158992819-158992841 GTATTGATTTATTTTGATCTGGG - Intronic
965393378 3:168132090-168132112 GGATGAAGTCATCTTGATCTTGG - Intergenic
966224677 3:177585171-177585193 GGATGGGTTCATTTTCAAGCTGG + Intergenic
969230532 4:5827218-5827240 GGCTGGCTTCATTTCCTTCTTGG - Intronic
970748035 4:19323251-19323273 GGATGAATTCAGATTCATGTAGG - Intergenic
971056996 4:22924581-22924603 GGCTGGATTCATGTTGATTTAGG - Intergenic
972249906 4:37288448-37288470 TGCTGTATTCATTTTCACCTTGG - Intronic
973672199 4:53231805-53231827 TGATGGATTTGTTTTCTTCTTGG - Intronic
974565426 4:63574428-63574450 GGATAGAATCATTTCCATCTTGG - Intergenic
977321240 4:95519295-95519317 AGATGGATTCTTATTCCTCTGGG - Intronic
979169135 4:117577444-117577466 ACATGGATTCACTTCCATCTGGG - Intergenic
981755604 4:148138847-148138869 GGATGGATTCATGTTCTGATAGG + Intronic
981811161 4:148776611-148776633 GGATTGTTTCCTTTTAATCTTGG - Intergenic
982663085 4:158229359-158229381 GGATGCCTTCTTCTTCATCTGGG + Intronic
983249989 4:165332520-165332542 GGATGTATTCATTTTGAATTAGG + Intronic
991392596 5:66163462-66163484 GAAATGATTCATTTTCATATTGG + Intronic
991599169 5:68335476-68335498 GAATGGCTTCATTTTCAGATAGG + Intergenic
994276741 5:97847496-97847518 GAAAGGGTTGATTTTCATCTAGG - Intergenic
995792833 5:115910528-115910550 GTATGAAGTAATTTTCATCTTGG - Intronic
997293068 5:132751693-132751715 GAATGGAAACATTGTCATCTAGG + Exonic
1001169396 5:169404451-169404473 GGAAGGCTTCTTTTTCTTCTTGG - Intergenic
1002823352 6:749847-749869 GTTTGGATTCAATTTCCTCTGGG + Intergenic
1003352870 6:5335420-5335442 TGATGGACTCTTTTTCATCTTGG + Intronic
1004257187 6:14075382-14075404 TGATGGTTTCATTTTCACTTAGG + Intergenic
1004825778 6:19419328-19419350 AGAAGGATTCATATTCATTTGGG + Intergenic
1008332141 6:50258188-50258210 TCAGGGATTCAGTTTCATCTTGG + Intergenic
1009871686 6:69460551-69460573 AGAAGGATTTATTTTCCTCTGGG - Intergenic
1011392634 6:86870922-86870944 GAAGGGATTCATTTTCTTCCTGG - Intergenic
1012578404 6:100831504-100831526 GCATGGATCAATTTTTATCTAGG - Intronic
1014594347 6:123314500-123314522 AGAAGGATTTATTTTCCTCTGGG - Intronic
1015646805 6:135400420-135400442 GGCTGAATTTATATTCATCTAGG + Intronic
1018952076 6:168385821-168385843 GGAGGTCTGCATTTTCATCTGGG + Intergenic
1021821417 7:24501290-24501312 GGGGGGATTCATTTTCATCTTGG - Intergenic
1021916915 7:25443434-25443456 GCATTGATTCTTTCTCATCTTGG + Intergenic
1022108152 7:27211327-27211349 GGTTGGCTTCAATTTTATCTGGG + Intergenic
1022530810 7:31065822-31065844 GGAGGGATTCATTTTCCTTCTGG + Intronic
1023613523 7:41995255-41995277 GGATGGATTCACATCCATCATGG - Intronic
1024097329 7:45993182-45993204 GGATGGATATAATTTCATTTGGG + Intergenic
1026939483 7:74278998-74279020 GGCTGAATTCATTTTCACCCTGG + Intergenic
1030499834 7:110345930-110345952 GGATAGATTTATTTTAATTTTGG - Intergenic
1030932618 7:115543593-115543615 GGATGGAGTTATTTACTTCTGGG - Intergenic
1032104032 7:129009971-129009993 TGATGGACTCATGTTCATTTAGG - Intronic
1033282383 7:140015462-140015484 GGATGAGTACATTTTCATCAAGG + Intronic
1035463221 7:159059156-159059178 GGAGGGATTCATGATCATCATGG + Intronic
1038137624 8:24805482-24805504 GCATGAATTCATTTTCAAGTTGG + Intergenic
1040575056 8:48644595-48644617 GGATGGAGTCATTTTTACCATGG - Intergenic
1041334594 8:56766784-56766806 GAATTGGTTCATTTTCATCTAGG + Intergenic
1041953998 8:63537163-63537185 GGATTGATTCTGTTTCTTCTAGG + Intergenic
1043021936 8:75012950-75012972 GGTTGCATTCATGTTCATATGGG - Exonic
1043775689 8:84265519-84265541 GGTAGGATTCACTTCCATCTGGG - Intronic
1044587332 8:93879894-93879916 GGATGGTTTCATTTCTATTTGGG + Intronic
1046126749 8:109919738-109919760 AGATTGGTTCATTTTCATCAAGG - Intergenic
1046436017 8:114190754-114190776 GGATGGAGTCAACTTGATCTTGG - Intergenic
1046621844 8:116536683-116536705 CGATGGAATCATTTCCAACTTGG + Intergenic
1046800066 8:118416580-118416602 GGATGGTTTGATTTTCACGTAGG - Intronic
1047287668 8:123502161-123502183 AGATGGACTCATTTTGATGTTGG + Exonic
1047417982 8:124681406-124681428 GGATGGTTACATTTTTATCGTGG - Intronic
1047995369 8:130330073-130330095 GGAGTGATTCATTTCCAGCTGGG - Intronic
1048602389 8:135931844-135931866 ACATGTATTCACTTTCATCTGGG + Intergenic
1048633912 8:136274780-136274802 GTATGTATACATTTTTATCTTGG - Intergenic
1048720141 8:137314065-137314087 GGGTGGAGTCATTTTCAAATGGG - Intergenic
1051308641 9:15744583-15744605 GAATGTTTTCTTTTTCATCTTGG - Exonic
1053591601 9:39520064-39520086 GCCTGGATACATTCTCATCTTGG - Intergenic
1053849447 9:42275422-42275444 GCCTGGATACATTCTCATCTTGG - Intergenic
1053948127 9:43336267-43336289 GAATGGAATCATCTTCATTTGGG - Intergenic
1054574707 9:66845225-66845247 GCCTGGATACATTCTCATCTTGG + Intergenic
1060832876 9:126729637-126729659 GGATAAATTCAATTTCGTCTTGG + Intergenic
1203591308 Un_KI270747v1:64466-64488 GAATGGAATCATCTTCATTTGGG - Intergenic
1186450067 X:9664826-9664848 GGCTGGATTGTTCTTCATCTTGG + Intronic
1186999620 X:15162281-15162303 AGCTAGATTCATTTTTATCTGGG + Intergenic
1187096154 X:16150668-16150690 GGATTGATTCATTTCCTCCTTGG + Intronic
1187279757 X:17848933-17848955 GAATGCATTCATTTTAATTTGGG - Intronic
1187283991 X:17885465-17885487 GGCTTGATTCCTTTTCATCTAGG - Intergenic
1187299666 X:18035901-18035923 GGGTGGATACATTATCATTTAGG - Intergenic
1187634738 X:21214824-21214846 TCATGGATTCAATTTCTTCTTGG - Intergenic
1187677805 X:21735082-21735104 GGATTGATTTTTTTTCTTCTTGG - Intronic
1189902418 X:45720359-45720381 ACATGGATTCATAGTCATCTGGG - Intergenic
1193581787 X:83273891-83273913 AGAAGAATTCATATTCATCTGGG + Intergenic
1194720854 X:97338239-97338261 GCATGTATTAATTTTCATTTGGG - Intronic
1194819084 X:98484072-98484094 GGATAGTCTCATTTGCATCTTGG - Intergenic
1196968967 X:121087795-121087817 GCAGGCATTCATTTTGATCTTGG + Intergenic
1199611561 X:149620835-149620857 GGATGAAGTCATTTTTATCTTGG - Intronic
1201483043 Y:14461173-14461195 GGATGAATCCAGCTTCATCTTGG - Intergenic
1202028340 Y:20548237-20548259 GAATGGATTCGTCTTCATTTTGG - Intergenic