ID: 1117824139

View in Genome Browser
Species Human (GRCh38)
Location 14:59683518-59683540
Sequence TTCTACAGTGAATGGATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117824139_1117824141 -3 Left 1117824139 14:59683518-59683540 CCTAAGATCCATTCACTGTAGAA 0: 1
1: 0
2: 2
3: 20
4: 258
Right 1117824141 14:59683538-59683560 GAATTAAATGTCACAAATGATGG 0: 1
1: 0
2: 3
3: 23
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117824139 Original CRISPR TTCTACAGTGAATGGATCTT AGG (reversed) Intronic
901121967 1:6903048-6903070 TTCTTCAGTTGATGGATATTTGG - Intronic
901847547 1:11993388-11993410 TTTTACAGTGCATGCATGTTAGG + Intronic
902151179 1:14444678-14444700 TTCTTCAGTGGATGCAGCTTGGG + Intergenic
902842741 1:19085777-19085799 TTCTACAGTGTGTGGCTCTGAGG - Intronic
905719337 1:40183457-40183479 TTCTAAAGTGAATGCTTCTGGGG - Intronic
906467699 1:46098445-46098467 TTCACCAGTTAATGGATATTTGG - Intronic
906941146 1:50256568-50256590 TTCTTTGGTGAATGGCTCTTAGG - Intergenic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908068252 1:60431348-60431370 TTTTACAGTGTATGGTTTTTTGG + Intergenic
909368593 1:74858377-74858399 CTCTGCAGTGCATGGATTTTGGG - Intergenic
910125974 1:83842924-83842946 TGTTACAATGAATGAATCTTTGG + Intergenic
911624054 1:100100457-100100479 TTGTTCAATGAATGAATCTTTGG + Intronic
916279555 1:163034365-163034387 TGCTAAAGTGATTGGATCTCTGG - Intergenic
916378736 1:164185074-164185096 TTCTACTGTTGATGGATATTTGG + Intergenic
916788544 1:168104564-168104586 ATCCGCAGGGAATGGATCTTTGG - Exonic
918711855 1:187741100-187741122 ATCTACAGTCAACTGATCTTTGG + Intergenic
918720351 1:187844680-187844702 TTCTACTGTGTATGGATCCATGG + Intergenic
918941038 1:190997215-190997237 TTCTAGAGGGATTGAATCTTAGG + Intergenic
920833685 1:209488159-209488181 CACTACAGAGAAGGGATCTTTGG + Intergenic
921888893 1:220333974-220333996 TTATAGAATGAATGGATCATTGG + Intergenic
1064714681 10:18164492-18164514 TTCTGCAGGCAATGGGTCTTTGG + Intronic
1066585685 10:36932295-36932317 TTCTACAGGCAAAGGATCCTTGG + Intergenic
1066929746 10:41742500-41742522 TTGTACTGTGAATGGACATTCGG + Intergenic
1067352787 10:45491954-45491976 TTCAACAGAGAATGGATATTGGG + Intronic
1067583391 10:47460633-47460655 TTCTCCTGTGAATGAATATTTGG + Intronic
1067633393 10:47985983-47986005 TTCTCCTGTGAATGAATATTTGG + Intergenic
1067909515 10:50332002-50332024 TTCTAAACAGAATGGATTTTAGG - Intronic
1070313515 10:75290806-75290828 CTCTAAATTGAATGGATGTTGGG - Intergenic
1071781946 10:88855802-88855824 TTGTACAGAGAGTGGATCTGAGG + Intergenic
1072213398 10:93267681-93267703 TCATACACTGAATGGATTTTAGG + Intergenic
1072297773 10:94028029-94028051 TTTTCCAGTGGAGGGATCTTTGG + Intronic
1072981610 10:100102836-100102858 TTCTTCAGTTAATGGACATTTGG + Intergenic
1075002164 10:118806714-118806736 TTCATCAGTGGATGGATGTTTGG - Intergenic
1075815727 10:125263733-125263755 TTCTACAGGAAATGGAGGTTTGG - Intergenic
1076946656 10:133656335-133656357 TTCTACAGAGAATAGCTCTGGGG - Intergenic
1079421510 11:20294417-20294439 TTCTCCAGTAGATGGACCTTTGG + Intergenic
1079863884 11:25710593-25710615 TACTACAGTTCATGGATATTAGG - Intergenic
1080138020 11:28880767-28880789 TTCAGCAGTTAATGGATATTTGG + Intergenic
1080594928 11:33764121-33764143 TTCTACTGTTAATGGATATTTGG - Intronic
1080756238 11:35202142-35202164 TTGTCAAGTGAATTGATCTTTGG + Intronic
1083705784 11:64513960-64513982 TTCTCCAGTGAAAGGAACTGGGG + Intergenic
1085902438 11:80717576-80717598 TTCTACAGGCAAAGGATCCTTGG - Intergenic
1086110421 11:83193100-83193122 TGCTACAGTGAAAGGATTCTCGG + Intergenic
1086663058 11:89445568-89445590 TAATACAGTCAATTGATCTTTGG + Intronic
1086923457 11:92614139-92614161 TTCATCAGTTAATGGATATTGGG + Intronic
1088055130 11:105565528-105565550 TTCATCAGTTAATGGATATTTGG - Intergenic
1088648891 11:111940057-111940079 TGCCACAGGGAATGGAGCTTTGG + Intronic
1088792678 11:113239995-113240017 TGGGACACTGAATGGATCTTTGG - Intronic
1089290503 11:117435260-117435282 TTCTTTAGTGAATGGGTCCTAGG + Intronic
1092832087 12:12454075-12454097 TTTTTCAGTGGATGGATATTTGG + Intronic
1093120680 12:15267564-15267586 TTCTACACAGAAGGGATCTGTGG - Intronic
1093346636 12:18044626-18044648 TTCTACAGATAAGGGAGCTTAGG + Intergenic
1095223059 12:39641543-39641565 TTCTACTGCTAATGGATGTTGGG - Intronic
1098070183 12:66665665-66665687 TTCTACTGTTAAGGGATATTTGG + Intronic
1098447246 12:70578955-70578977 TTCTCCAGAGAATGGAGGTTGGG - Intronic
1099930882 12:89073104-89073126 TTCTACATTGATTGGTGCTTGGG + Intergenic
1101515530 12:105431438-105431460 TTAAACAGAGAATGGTTCTTAGG - Intergenic
1102340538 12:112118052-112118074 TTCTACAGTTAATGAACATTTGG - Intergenic
1103046038 12:117735296-117735318 CTCTAGAGTGAATAGATCTGGGG + Intronic
1103161876 12:118736023-118736045 TTCATCAGTTAATGGATATTTGG - Intergenic
1104740234 12:131166527-131166549 ATATTCACTGAATGGATCTTTGG + Intergenic
1106233760 13:27843725-27843747 TTCATCAGTTAATGGATATTTGG - Intergenic
1106401193 13:29432671-29432693 TTGGACAGTGAAGGGAGCTTAGG - Intronic
1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG + Intergenic
1111244597 13:85519286-85519308 TTATACAATGAATGAAACTTGGG - Intergenic
1112091386 13:96088273-96088295 TTCTTCAGTGACTGTATTTTCGG + Intergenic
1113508878 13:110835876-110835898 TTCTATAGTGAAAGGAACTGTGG + Intergenic
1113712202 13:112474146-112474168 TTCTACTGTTAATGGATATTTGG - Intergenic
1115084117 14:29492941-29492963 TTCTCCAGTGTATGGAACTCTGG + Intergenic
1115229884 14:31148907-31148929 TTCTGCAGTAAATGAATGTTTGG + Exonic
1115983426 14:39078543-39078565 TTCTACAGAGAGTAGTTCTTAGG - Intronic
1116086490 14:40245610-40245632 TTCATCTGTGAATGGATATTTGG + Intergenic
1117824139 14:59683518-59683540 TTCTACAGTGAATGGATCTTAGG - Intronic
1118541038 14:66825838-66825860 TTCTATAGTTAGTGGTTCTTTGG + Intronic
1119832344 14:77714679-77714701 ATCTACAATGAATGGATCATTGG + Intronic
1120001218 14:79305406-79305428 TTCCACAGCCAATGTATCTTTGG + Intronic
1120010491 14:79407853-79407875 GTCTTTAGTGAATGGAACTTCGG + Intronic
1120329673 14:83075643-83075665 TTCCACAGCAAATGGTTCTTGGG - Intergenic
1121203666 14:92142384-92142406 TGCTACAGTGATTGGGTCTGTGG + Intronic
1121828759 14:97032380-97032402 TTCATCAGTGGATGGATATTTGG - Intergenic
1122157152 14:99756459-99756481 TCCCACAGTGAATGGCTCATCGG + Intronic
1202920743 14_KI270723v1_random:28889-28911 TTCTACAGAGAATAGCTCTGGGG - Intergenic
1202924176 14_KI270724v1_random:8692-8714 TTCTACAGAGAATAGCTCTGGGG + Intergenic
1126755188 15:51918887-51918909 GTTTACTGTGAGTGGATCTTAGG - Intronic
1127133103 15:55888799-55888821 ATCTACAGTGAATTCATATTGGG + Intronic
1128416886 15:67454797-67454819 TTCATCAGTGAATGGGTATTTGG + Intronic
1129658423 15:77539895-77539917 TTCTACAGTGAATTGACTGTAGG + Intergenic
1130601241 15:85275432-85275454 ATCTACAATGCATGGATCATTGG - Intergenic
1134505135 16:14799239-14799261 TCCTACATTAAATGGATTTTTGG - Intronic
1134575441 16:15329671-15329693 TCCTACATTAAATGGATTTTTGG + Intergenic
1134727004 16:16426821-16426843 TCCTACATTAAATGGATTTTTGG - Intergenic
1135324730 16:21519198-21519220 TGTTACAGTGAATGGAGGTTCGG - Intergenic
1136738758 16:32491876-32491898 TCCTTCTGTGAATGGATATTTGG + Intergenic
1138718631 16:59052941-59052963 GACTTCAGAGAATGGATCTTTGG + Intergenic
1138757491 16:59506018-59506040 TTCTCAAATGAATGGCTCTTTGG - Intergenic
1140988349 16:80182418-80182440 ATTTACAGTTAATTGATCTTTGG + Intergenic
1141215183 16:82017159-82017181 TTCAACAGTTGATGGATATTTGG - Intergenic
1203014455 16_KI270728v1_random:339915-339937 TCCTTCTGTGAATGGATATTTGG - Intergenic
1203032790 16_KI270728v1_random:613074-613096 TCCTTCTGTGAATGGATATTTGG - Intergenic
1143425199 17:6830819-6830841 TTCTACTGTTTATGGATATTTGG + Intronic
1144156202 17:12506239-12506261 TTCACCTGTGAATGGGTCTTTGG - Intergenic
1144434256 17:15224948-15224970 TTCAACAGTTAATGGACATTTGG + Intergenic
1147898825 17:43770220-43770242 TTCTACTGTGGATGGGCCTTTGG - Intronic
1148532020 17:48402669-48402691 TTCATCAGTTAATGGATATTTGG - Intronic
1148910193 17:50938384-50938406 TTCTTCAGTGAAAGGATCCGGGG - Intergenic
1150545482 17:66153282-66153304 TTCACCAGTTAATGGATATTTGG - Intronic
1151247988 17:72810343-72810365 TTCTTCTGTGAATGGATGCTTGG - Intronic
1155099270 18:22593256-22593278 TTTTATTGTTAATGGATCTTTGG - Intergenic
1155822882 18:30400258-30400280 TTCTACAGTTGATGGACCCTTGG + Intergenic
1156852467 18:41744535-41744557 TTCTGCAGTGGAAAGATCTTAGG - Intergenic
1157720475 18:49919908-49919930 TTCATCAGTGGATGGATGTTTGG - Intronic
1157874755 18:51261805-51261827 TTCCCCAGTGTATGGATCGTGGG - Intergenic
1159006049 18:63013259-63013281 TTCTACTGTTAATGGACATTTGG + Intergenic
1159484257 18:69033641-69033663 TTCATCAGTTAATGGATATTTGG + Intronic
1159882110 18:73867863-73867885 TTCTAGAGTGAATGGCTATGTGG + Intergenic
1159979683 18:74762964-74762986 ATCTAAAGTGATTGGATTTTAGG + Intronic
1160656241 19:272125-272147 TTCTACAGTGAAAGGAACCAGGG + Intergenic
1166608005 19:44162630-44162652 TTCTACAGGGAGTGGATTATTGG - Intergenic
1167401719 19:49276268-49276290 TTCTTCAGTGAAGCCATCTTTGG - Intergenic
1168488208 19:56783168-56783190 TTCTACTGTTAATGAATGTTTGG - Intronic
926949226 2:18223580-18223602 TTCTATTGTCAATGGATATTTGG + Intronic
927068721 2:19502227-19502249 TTATAAAGTGTTTGGATCTTTGG + Intergenic
927838998 2:26425315-26425337 TTCTCCTGTGAATGGACATTTGG + Intronic
929208422 2:39325199-39325221 TTTTACAGTGAATGATTATTTGG + Intronic
930468985 2:51789689-51789711 TTCTACAGTTCAGGGGTCTTGGG - Intergenic
930908041 2:56597387-56597409 TTATTCAGTTAATGGATATTTGG - Intergenic
931000701 2:57778493-57778515 TTCTACTGACAATGGATATTTGG + Intergenic
931355625 2:61536404-61536426 TTATCCAGTGAGTGGATTTTAGG - Intronic
931606176 2:64054543-64054565 TTTTAAAGTGAGTTGATCTTAGG - Intergenic
932945682 2:76227271-76227293 ATCTACATTGAATAAATCTTTGG + Intergenic
932987846 2:76748340-76748362 TTCTACACTGCATGGTTCCTGGG - Intronic
933676806 2:85064340-85064362 TTCATCAGTGAATGGACATTTGG - Intergenic
934895938 2:98119915-98119937 TCCCACAGTGAATAAATCTTAGG + Intronic
935942969 2:108260491-108260513 TTCTATAGTGAATGGTTCCTAGG - Intronic
939034293 2:137112413-137112435 TTTGCCAGTGAATGGAACTTGGG + Intronic
944696589 2:202206695-202206717 TTCTTCAGTGAAGCCATCTTTGG + Exonic
947294635 2:228617093-228617115 TTCTATAGATAATGGATTTTAGG + Intergenic
947710336 2:232310110-232310132 CTCTGCAATGAATGGCTCTTAGG - Intronic
1171239841 20:23556979-23557001 TTTTAACGTGAATGGATGTTGGG + Intergenic
1173048219 20:39532948-39532970 TTCTTCAGGGAATGAGTCTTGGG - Intergenic
1173408826 20:42791568-42791590 TTCTAGAGTGACTTGATCTCTGG - Intronic
1173885705 20:46457327-46457349 TGCTCAAGTGAATGGATCTGGGG - Intergenic
1176331055 21:5548703-5548725 TTCTACAGAGAATAGCTCTGGGG + Intergenic
1176396702 21:6272248-6272270 TTCTACAGAGAATAGCTCTGGGG - Intergenic
1176440455 21:6716856-6716878 TTCTACAGAGAATAGCTCTGGGG + Intergenic
1176464717 21:7043925-7043947 TTCTACAGAGAATAGCTCTGGGG + Intergenic
1176488278 21:7425704-7425726 TTCTACAGAGAATAGCTCTGGGG + Intergenic
1176993895 21:15531265-15531287 TTCACCAGTTAATGGATATTTGG - Intergenic
1177071322 21:16512370-16512392 TTATACAGTTAATTTATCTTCGG + Intergenic
1177286000 21:19050718-19050740 TTCCACAGTAAATGGATATTAGG - Intergenic
1178736969 21:35161263-35161285 TTCTACAGAAGATGGAGCTTGGG - Intronic
1182721082 22:32401042-32401064 TTCTGAAGTCAAAGGATCTTTGG + Intronic
1183294560 22:37021997-37022019 TTCTACTGTAAATGGATGATTGG + Intronic
1183600343 22:38836350-38836372 TTCTTCTGTGGATGGATCTGTGG - Intronic
949828727 3:8190916-8190938 ATCTACAGTGAATGCATTTTTGG - Intergenic
951065461 3:18259882-18259904 TTCTGCAATGAATATATCTTTGG + Intronic
952421559 3:33136292-33136314 TTCTTCAGTTGATGGATGTTTGG + Intronic
954600335 3:51862739-51862761 TTCTGCAGTGCATGGATCAAGGG - Intronic
954846739 3:53565965-53565987 TTCTACAGAGAAAGGGTCATGGG - Intronic
955147851 3:56337845-56337867 TTCTACTGTTGATGGATATTTGG - Intronic
956468337 3:69541050-69541072 TCCTAAAGGGAATGGATCTGTGG - Intronic
956495989 3:69826458-69826480 TTCTACTGTTGATGGATATTTGG + Intronic
957080799 3:75634074-75634096 TTCTACAGAGAATAGCTCTGGGG + Intergenic
957234560 3:77569050-77569072 TTCTTCAGTTGATGGATGTTCGG + Intronic
958779782 3:98526422-98526444 TTCTACAGTGAATGGGTGCAAGG - Intronic
959107814 3:102085200-102085222 TTCTTCTGTTAATGGATATTTGG + Intergenic
963701064 3:148627325-148627347 TTCATCAGTGAATGGAAATTTGG - Intergenic
965299572 3:166993237-166993259 TTATAAAGTTAATGCATCTTAGG - Intergenic
965978285 3:174653261-174653283 TTCTACTGTGGATGGACATTTGG - Intronic
970346774 4:15159896-15159918 TTATACATTCAGTGGATCTTAGG + Intergenic
970355747 4:15250433-15250455 TTTTACATTTAATGGCTCTTAGG + Intergenic
970626878 4:17895934-17895956 TTCTTCAGTTAATGGACATTTGG + Intronic
971954577 4:33400057-33400079 ATATACAGTGAATTCATCTTTGG + Intergenic
973756758 4:54082370-54082392 TGCTCCACTGTATGGATCTTTGG + Intronic
974454392 4:62107510-62107532 CTCTACTGTTAATGGATATTTGG + Intergenic
974833546 4:67218507-67218529 TTCATCAGTGAATGGACATTTGG + Intergenic
975134363 4:70860167-70860189 TTCTACTGTGAAAGGATATTCGG + Intergenic
975598467 4:76073926-76073948 TTCTACTGTTGATGGATATTTGG + Intronic
975692577 4:76980322-76980344 TTTTACAGTGATTGTTTCTTGGG + Intronic
975752887 4:77542407-77542429 TTCTACTCTGAAGGGATTTTTGG + Intronic
976200208 4:82570462-82570484 CTTTACAGTGAATGACTCTTTGG + Intergenic
976914478 4:90353773-90353795 TTCTACAATGAATAGATATGAGG + Intronic
977095715 4:92741187-92741209 TTTTACAGTGAAAGGAACTGAGG - Intronic
977601208 4:98935713-98935735 TTCTTCAGTCAATGGATTTTGGG - Intergenic
977775217 4:100910870-100910892 TTCATCATTGAATGCATCTTTGG + Intergenic
978667894 4:111208437-111208459 GTCTACAATAAATGGATCTTCGG - Intergenic
980323283 4:131307068-131307090 TGCTACAGTGAATGGTGCTGTGG - Intergenic
981045246 4:140258603-140258625 TTCTACAATGAATGAATCTCTGG - Intronic
981736695 4:147960946-147960968 TTCTACTGTTAATGGACATTTGG + Intronic
982058471 4:151577865-151577887 TTCTAAAATGGATGGATCTTTGG - Exonic
982555530 4:156858044-156858066 TTATACAGTGAATATATGTTTGG + Intronic
983285048 4:165728541-165728563 TTCTTCAGTGAGTGGATCTTGGG - Intergenic
983976662 4:173943123-173943145 TTGGACAGTGAATAGAACTTAGG - Intergenic
983985766 4:174059321-174059343 TTCAACAATTAATGGATATTTGG - Intergenic
984109638 4:175596276-175596298 ATCTACACAGAATGGATTTTTGG + Intergenic
984363172 4:178764177-178764199 TTCTCCAGTTAATGGACATTGGG + Intergenic
985853368 5:2405580-2405602 TTCTACAGTTGATGGATCCTGGG - Intergenic
987686558 5:21211511-21211533 TTATACAGTGATTGAATTTTGGG - Intergenic
988194772 5:27990296-27990318 TTCTACAGTGGAATGATATTAGG - Intergenic
988489855 5:31697134-31697156 TTCTACAGTGAATGCTTCTATGG - Intronic
988857510 5:35243489-35243511 TTCTATAATCAATGGAACTTGGG + Intergenic
990153132 5:52843171-52843193 TTTTACAGTGAATGGTTTTAGGG - Intronic
992603269 5:78426959-78426981 TTCACCAGTTAATGGATATTTGG + Intronic
992968265 5:82026372-82026394 TTCTTCTGTTAATGGATATTGGG + Intronic
993408424 5:87542948-87542970 TGCTACAGAAAATGGATATTTGG + Intergenic
994079613 5:95693320-95693342 TTCTACAGTTGATGAATATTTGG - Intronic
994342365 5:98645931-98645953 TTCTTCAGTGAAGCCATCTTTGG - Intergenic
994509587 5:100687287-100687309 CTCTGCAGTTGATGGATCTTAGG - Intergenic
995026970 5:107435021-107435043 TTCTAGAGTGAATATATCTTGGG + Intronic
995445023 5:112233064-112233086 TTCTACTGTTGATGGATATTTGG - Intronic
995766062 5:115620805-115620827 TTCACCAGTGGATGGAACTTGGG + Intronic
997406046 5:133647693-133647715 GACTACAGTGAATGGATTTCTGG - Intergenic
997689207 5:135814260-135814282 ATCTTCAGGGAATGGATCTAAGG - Intergenic
997789150 5:136741238-136741260 TTATAGAGTGACTGTATCTTTGG - Intergenic
999490686 5:152047500-152047522 TGATACAATGAATGGATTTTGGG - Intergenic
999495295 5:152090791-152090813 TACTACTGTGACTGGAGCTTAGG + Intergenic
1000601158 5:163276366-163276388 TCGTACAATTAATGGATCTTAGG - Intergenic
1006135943 6:31896810-31896832 CTCTACAGTTCATGGCTCTTTGG - Exonic
1009259182 6:61462116-61462138 TTATTCTGTGAATGGATATTTGG + Intergenic
1013343746 6:109239669-109239691 TCCTAAAGTGAATGCATTTTAGG - Intergenic
1014667074 6:124252178-124252200 TTCTACTGTTAATGGATTTCTGG - Intronic
1016461233 6:144282354-144282376 TTCTACAGCGATCTGATCTTTGG + Intergenic
1018745979 6:166762494-166762516 TTCTTAAGTGAAAGTATCTTGGG + Intronic
1019837230 7:3400176-3400198 GCCTACTGTGAATGGAGCTTAGG + Intronic
1021553124 7:21893063-21893085 TTGTACTGTGAATGGATGTTTGG + Intronic
1023394583 7:39740969-39740991 TTCTACTGTTGATGGATATTTGG + Intergenic
1024239904 7:47426778-47426800 ATCCACAGTGCATGGAACTTCGG + Intronic
1024515504 7:50250956-50250978 TTGGACACTGAATGGATTTTAGG - Intergenic
1024753110 7:52492951-52492973 TTCTACAGTTGATGGATGTTTGG + Intergenic
1026480883 7:70778477-70778499 CTCTAGAGTGACTGGAACTTGGG - Intronic
1028247065 7:88492340-88492362 TGATACACTGAATGGATGTTAGG - Intergenic
1028326229 7:89528446-89528468 TTCAACAGTTGATGGACCTTTGG + Intergenic
1029937558 7:104443358-104443380 ATCTCCAGTGCATGGATGTTTGG + Intronic
1030321365 7:108171812-108171834 TTCAACAGTGAATGTCTCTCTGG - Intronic
1033152446 7:138927203-138927225 ATCTACAGTGGATGGAGATTTGG + Intronic
1033182504 7:139194677-139194699 TTCTCCTGTGAATGGATATTTGG - Intergenic
1035732606 8:1863448-1863470 TTCTAAAGGGAATTTATCTTTGG - Intronic
1036167966 8:6455594-6455616 TTCAAAAGTGAATGAATGTTTGG - Intronic
1037123779 8:15320451-15320473 TTCTACAGTTAATAGGTCTCAGG - Intergenic
1038223193 8:25630288-25630310 TCCTACAGTGGAAGGAGCTTTGG + Intergenic
1039749875 8:40468360-40468382 ATCTACAGCCAATTGATCTTTGG + Intergenic
1041349148 8:56931136-56931158 TCCTACAGTAAAGGGGTCTTAGG + Intergenic
1042532225 8:69827983-69828005 TTCTACAGTGCATGGCTCTTTGG - Intronic
1042884601 8:73534118-73534140 CTCCACAGTTAATGGATCTGAGG - Intronic
1044337836 8:91008781-91008803 TTTTACAGTGGATGGAACTGAGG - Exonic
1045737481 8:105313778-105313800 GTCTACAGTGATTGGCTCTATGG - Intronic
1047885671 8:129247651-129247673 TTCTCCAGTGATTAGATATTTGG - Intergenic
1048350995 8:133616357-133616379 GTCTACAGTGAATGGGCATTTGG + Intergenic
1049031995 8:140044852-140044874 CTTTAGAGTGAATGCATCTTAGG - Intronic
1051450152 9:17188566-17188588 TATTTCAGTGAAAGGATCTTAGG + Intronic
1054362591 9:64191008-64191030 TTATTCTGTGAATGGATATTTGG + Intergenic
1055243373 9:74211866-74211888 TTCTTCAATGAATGGAGCTGGGG - Intergenic
1057498810 9:95581011-95581033 TTCTACAGTGATTAGATTTATGG + Intergenic
1058749187 9:108022425-108022447 TTCATCAGTTAATGGATGTTTGG + Intergenic
1059096582 9:111422600-111422622 CTCTACAGTGAAAGGAGCTTTGG - Intronic
1061172988 9:128972545-128972567 TTGTACATTGTATGGATTTTTGG - Intronic
1061229447 9:129305845-129305867 TTCTTCTGTTAATGGATATTTGG - Intergenic
1061843199 9:133372167-133372189 TTCTACAGAGCATGGCTCCTGGG + Intronic
1203431047 Un_GL000195v1:91623-91645 TTCTACAGAGAATAGCTCTGGGG - Intergenic
1186165026 X:6818649-6818671 CTATATAGTGAATGCATCTTGGG + Intergenic
1186990886 X:15066127-15066149 TTCTCCAGTTAATGGACATTTGG - Intergenic
1187375622 X:18750543-18750565 TTCATCAGTGAATGGACATTTGG + Intronic
1187631154 X:21174177-21174199 TTGTGCAGAGAATGGAACTTTGG - Intergenic
1187666661 X:21619550-21619572 GTCTTAAGTGAATAGATCTTAGG - Intronic
1187754267 X:22503099-22503121 TTCTAGTATTAATGGATCTTTGG + Intergenic
1190212769 X:48460970-48460992 TTCTACAGTGAGTGGGGCTGGGG - Exonic
1191044833 X:56124943-56124965 TTCTACACTGAGTTGATTTTAGG + Intergenic
1192083552 X:68071517-68071539 TTCTACAGCAAATGGCTCTAAGG + Intronic
1192304739 X:69947110-69947132 TTCTAAAGTGAAAGGTGCTTTGG - Intronic
1193656122 X:84199827-84199849 TTCTACAGTTGAAGGATTTTTGG - Intergenic
1194109498 X:89815650-89815672 TTCTATAATGATTGGATTTTAGG + Intergenic
1194762620 X:97812310-97812332 AGCTACAGTGAATAGATCTGTGG - Intergenic
1195453667 X:105043620-105043642 TTCCACATTGTAAGGATCTTGGG - Intronic
1195605188 X:106798396-106798418 TTCAACAGTTAATGAACCTTTGG + Intergenic
1196750519 X:119112941-119112963 TTCATCAGTTAATGGATATTTGG - Intronic
1198524442 X:137486470-137486492 ATCTACAGTCAATTGATTTTTGG + Intergenic
1198714916 X:139547678-139547700 TTCTACTGTTAATGGATATTTGG - Intronic
1199539110 X:148938612-148938634 TTCTTTAGTGATTGCATCTTTGG - Intronic
1199550272 X:149053885-149053907 TTATTCAGTTGATGGATCTTTGG + Intergenic
1200462160 Y:3470392-3470414 TTCTATAATGATTGGATTTTAGG + Intergenic
1201903300 Y:19065024-19065046 TTCCAAAGAGAATGGATCTCAGG + Intergenic