ID: 1117830295

View in Genome Browser
Species Human (GRCh38)
Location 14:59743503-59743525
Sequence GCATTGCCAGAAAGAGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117830294_1117830295 20 Left 1117830294 14:59743460-59743482 CCAAGTATCTTTACGGCAGGAAA 0: 1
1: 0
2: 1
3: 9
4: 64
Right 1117830295 14:59743503-59743525 GCATTGCCAGAAAGAGTACAAGG 0: 1
1: 0
2: 0
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117830295 Original CRISPR GCATTGCCAGAAAGAGTACA AGG Intronic
902156587 1:14492519-14492541 ACATGGCCAGAAAAAGCACAAGG + Intergenic
902865137 1:19273112-19273134 AGTTTGCCAGGAAGAGTACAAGG - Intergenic
902867228 1:19287711-19287733 AGTTTGCCAGGAAGAGTACAAGG - Intronic
902952226 1:19894385-19894407 TCATTGCCAGCAAAAGTACCAGG - Exonic
904511435 1:31012398-31012420 TCATTACAAGAAAGAGTACAAGG - Intronic
905222291 1:36456730-36456752 GCATTTCCAGGAAGAGCACAAGG - Intronic
905978943 1:42205280-42205302 ATATAGCCAGAAATAGTACATGG - Intronic
906324662 1:44837731-44837753 GTATTGCCAGAGATAGAACAAGG + Intronic
908918862 1:69166246-69166268 TTATTACCAGACAGAGTACAGGG + Intergenic
909074504 1:71036968-71036990 ACACTGCCAGAGTGAGTACATGG - Intronic
912712146 1:111957698-111957720 GGTTTGCCATAAAGAGTAGAGGG - Intronic
913361773 1:117989081-117989103 GCGTTGCCAGATAAAGTATAGGG + Intronic
916063794 1:161120139-161120161 CCAATGCCAGAGAGAGTTCAGGG - Exonic
917153095 1:171965604-171965626 GAATAGCCAGAAGAAGTACATGG + Intronic
919675981 1:200383844-200383866 GCATTCCCTGAAATATTACATGG + Intergenic
920088814 1:203437832-203437854 TCATTGCCAGAAAAATTCCAGGG - Intergenic
923951141 1:238955705-238955727 GCATTCGCAGAAAGAGTCAAGGG + Intergenic
923969803 1:239187402-239187424 GCATTGACAGAATGTCTACATGG + Intergenic
924434067 1:244023166-244023188 TCATTGTCAGAGAGAGTATAGGG + Intergenic
1066146941 10:32569975-32569997 GCATGTTCAGAAAGAGTATATGG - Intronic
1069123466 10:64598917-64598939 GTATTCTCAGAAAGAATACATGG - Intergenic
1070574278 10:77665672-77665694 GCATTGCAGGACAGAGTAGAGGG + Intergenic
1071714759 10:88084465-88084487 GCAATGCCATAAATAGTAGAAGG - Intergenic
1073539522 10:104307012-104307034 ACAGAGCCAGAGAGAGTACAAGG - Intergenic
1077643480 11:3902816-3902838 GCATTGCCAGAAGGAGGAGCTGG + Intronic
1078522045 11:12071227-12071249 CCACTGCCAGAAACAGTAGAAGG - Intergenic
1080241226 11:30129330-30129352 GCAATGCCAGAAGGAGTGCTTGG + Intergenic
1080688637 11:34536870-34536892 GCATGTCAAGGAAGAGTACATGG - Intergenic
1081806636 11:45894440-45894462 GCAATGCTAGAAAGAATACTGGG - Intronic
1083140152 11:60714925-60714947 GCAAAGCCACAAAGAGTCCATGG + Intronic
1085327080 11:75614474-75614496 GTAATCCCAGAGAGAGTACAAGG - Intronic
1087316415 11:96608582-96608604 TCATTCCCAGAAAAAGTACATGG - Intergenic
1092219713 12:6704618-6704640 GCAGAGCCAGAAACAGGACAAGG - Intergenic
1092355843 12:7794641-7794663 GGATTAACAGAAAGGGTACAAGG - Intronic
1092685861 12:11045229-11045251 GCATGGACATAGAGAGTACATGG + Intronic
1094008387 12:25780655-25780677 CCACTTCCAGAAAGACTACAAGG - Intergenic
1098544283 12:71694236-71694258 GCATTGCCAGAATAAGGAGAGGG + Intronic
1100016158 12:90013334-90013356 AAATTGCCAGAACCAGTACATGG + Intergenic
1100828064 12:98493217-98493239 GCAATGCGGGAAAGAGTATATGG - Intronic
1102545895 12:113655203-113655225 ACATTGCTAGAAAGACTATATGG - Intergenic
1105760919 13:23513790-23513812 GCATGGCCAGTCAGAGTAGAAGG + Intergenic
1107232413 13:38125811-38125833 GTATTGCAAGAAAGAGAAAATGG - Intergenic
1109649976 13:65311677-65311699 ACATTGCCAGAATGAGTAACTGG - Intergenic
1111825531 13:93262846-93262868 CCATTGCAAGAAGGAGTTCAGGG + Intronic
1113289675 13:108890803-108890825 ACATTGCCAGAAAGAATGCCAGG - Intronic
1113693871 13:112330459-112330481 GCGTTTCCAGAAAGAGCAGATGG - Intergenic
1116189237 14:41641985-41642007 CCATTGTCAGAAATAGAACATGG - Intronic
1117830295 14:59743503-59743525 GCATTGCCAGAAAGAGTACAAGG + Intronic
1119185525 14:72639235-72639257 TCATTGCCAGGAACTGTACAAGG + Intronic
1120300995 14:82706524-82706546 TCCTTGCCATAAAGAGAACAAGG + Intergenic
1202931091 14_KI270725v1_random:32000-32022 GCAGGACCAGAAAGAGGACAGGG - Intergenic
1124207899 15:27738775-27738797 GTATTTCCAGAAAGCATACAGGG + Intergenic
1124221993 15:27857728-27857750 GGATTTCCAGAAAGAGAAGATGG + Intronic
1127416113 15:58758784-58758806 GCATTGTTACAAAGAGTAAATGG - Intergenic
1137354571 16:47748305-47748327 GCATTTCCAGACACAGCACACGG - Intergenic
1137488301 16:48909767-48909789 GCATTCCCAGAACTAGCACAAGG + Intergenic
1138937482 16:61746725-61746747 TCAGTGCCAGACAGAGTTCATGG + Intronic
1141142855 16:81508530-81508552 GCATTGCTTGAAAGAGTAAAAGG - Intronic
1147762867 17:42812059-42812081 ACCTTTCCAGGAAGAGTACATGG + Intronic
1148945953 17:51261436-51261458 CCATTGCCAGAAAGGGTATCTGG - Intronic
1150709374 17:67517001-67517023 GCATTGACAGAAAGGGTGCAAGG - Intronic
1153969381 18:10211724-10211746 GCATTGGGAGAAAGAATAAAAGG + Intergenic
1159315205 18:66764277-66764299 GCAGTCCCAGAGACAGTACATGG - Intergenic
1160046224 18:75389948-75389970 GCTGTGCCAGGAAGAGTAGAGGG + Intergenic
1160265163 18:77335818-77335840 GCAATGGCAGAAAGAGGCCAAGG + Intergenic
1161908731 19:7176803-7176825 GCACTGCTATAAAGAATACATGG - Intronic
1165699895 19:37929519-37929541 GAATTGCCAGACAGAATACTTGG - Intronic
1165990022 19:39805390-39805412 GCATTTCAAGAAAGAGAACCAGG + Intergenic
925235170 2:2271731-2271753 GCAATGCCAGAGTGAGGACAGGG - Intronic
925773129 2:7303839-7303861 GAATTGATGGAAAGAGTACAAGG + Intergenic
925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG + Intergenic
932709692 2:74053267-74053289 CCATTGTCAGAAACAGGACAAGG + Intronic
937382089 2:121387648-121387670 ACATTTCCTGAAAGAGGACAAGG + Intronic
937648204 2:124289615-124289637 GCATAGCCAGACAGAGGACCAGG + Intronic
938948784 2:136238536-136238558 TCATTGCCAGAAACACTAGAGGG + Intergenic
939659454 2:144870207-144870229 GCAATGTCAGAAAGAGGAGAGGG + Intergenic
939659600 2:144871713-144871735 GCAATGTCAGAAAGAGGAGAGGG - Intergenic
940235609 2:151508097-151508119 CTATTCCCAGAAAAAGTACAAGG - Exonic
942419350 2:175792088-175792110 AAATTCCCAGAAAGAGTAAAGGG + Intergenic
942953993 2:181752586-181752608 GCATTGTAAGAAACTGTACAGGG + Intergenic
943351724 2:186804875-186804897 GCATTGCAATAAACAGTACAGGG - Intergenic
944960019 2:204862188-204862210 TCATTGCCAAAATGAGGACAAGG - Intronic
945021534 2:205577593-205577615 GCAAAGACTGAAAGAGTACATGG + Intronic
945104252 2:206294442-206294464 GCCTTGGCAGAGAGAGGACAAGG + Intronic
947284005 2:228490217-228490239 GCATTGCCAAAAAGAAGACTCGG - Intergenic
947348444 2:229218488-229218510 GCTTTGCCAGCAACAGCACAAGG + Intronic
947827361 2:233115453-233115475 GCATTTCCAGAAACAGTTCCTGG - Intronic
948300107 2:236899492-236899514 TCATAGCCAGAAAGAGCAGATGG - Intergenic
1170338508 20:15297504-15297526 GCATTGACAGAAAGAGGGCAGGG + Intronic
1171432932 20:25096734-25096756 GCATTGGCTGAAATAGAACAAGG + Intergenic
1172314761 20:33945013-33945035 GCATTGGTAGAAAGAGCCCATGG - Intergenic
1172456917 20:35083738-35083760 GCCTCCCAAGAAAGAGTACATGG - Intronic
1174766724 20:53261321-53261343 GCATTAAAAGAAAGAGAACAAGG - Intronic
1175137259 20:56833481-56833503 ACAGTGCCAGAAACAGTGCAAGG + Intergenic
1175333292 20:58179140-58179162 TCATTGCCACAAACAGGACAGGG + Intergenic
1175461934 20:59158338-59158360 GCATTTCCAGAAAGGGTCCAGGG + Intergenic
1175777225 20:61661029-61661051 TCATTGCCAGAAAGAAGCCATGG + Intronic
1176593114 21:8660622-8660644 GCAGGACCAGAAAGAGGACAGGG - Intergenic
1178677849 21:34646416-34646438 ACATTCCCAGAAAGGCTACAGGG - Intergenic
1178817913 21:35948495-35948517 GCACAACCAGACAGAGTACAGGG + Intronic
1180275961 22:10637749-10637771 GCAGGACCAGAAAGAGGACAGGG - Intergenic
1181612818 22:24030283-24030305 GCTGTGCTAGAAAGAGTACTGGG + Intronic
1182664993 22:31951552-31951574 CCACTGCCAAAAACAGTACAGGG - Intronic
1184973773 22:48046530-48046552 GCTTTGGCAGAAAGAGTTCTGGG - Intergenic
949298703 3:2557948-2557970 TCATTTCCAGAAAAAGTTCAAGG - Intronic
949821881 3:8124558-8124580 GACTGGCCAGAAAGAGTTCATGG + Intergenic
949853941 3:8442777-8442799 GGATTGCCAGAAACAGCAGAAGG + Intergenic
950893338 3:16425178-16425200 GCATTGCAAGGTAGACTACAGGG - Intronic
951313078 3:21153669-21153691 GCTTTGCATGAAAGAGTCCATGG - Intergenic
951780076 3:26353037-26353059 CCATTGCCAGAGAGAAAACAAGG + Intergenic
953546693 3:43868808-43868830 CCATTGCCAGAAACACTACCTGG + Intergenic
956944490 3:74204309-74204331 TCATTAACAGAAACAGTACATGG + Intergenic
957934694 3:86927307-86927329 GCATAGCCTGAATGAGTAGATGG - Intergenic
961523255 3:127480445-127480467 GCATCTCCAGGAAGAGGACAAGG + Intergenic
961584097 3:127908185-127908207 GCATTTACAGAAAGTGTGCATGG + Intergenic
962567371 3:136675290-136675312 GCATTGGAAGCAAGAGGACAGGG - Intronic
963171942 3:142260385-142260407 CCATTGCGAGAAAGAATTCAGGG + Intergenic
963322816 3:143827920-143827942 CCAGTGCTAGAAAGAGTGCAGGG - Intronic
964770448 3:160219358-160219380 GAATTGCCACAAACAGTAGATGG + Intergenic
965475278 3:169148407-169148429 ACATTGGAAGAAAGAATACAGGG + Intronic
966398193 3:179522839-179522861 GTTTGGACAGAAAGAGTACAGGG + Intergenic
967954690 3:194869215-194869237 GATATGCGAGAAAGAGTACAGGG + Intergenic
969256483 4:6005566-6005588 TCATGGCCAGCAAGAGGACATGG - Intergenic
969459489 4:7321512-7321534 CCAGTGCCAGAAAGAGTCCCGGG - Intronic
970503231 4:16700252-16700274 GAATTGCCAAATAGAATACAGGG - Intronic
970542371 4:17092909-17092931 GCACTGCCAGGAAGAGGCCAAGG + Intergenic
971773901 4:30934874-30934896 ACATTTCCAGAAAGAGAACCTGG + Intronic
972150371 4:36082046-36082068 GCATTGCCAAATAGGATACATGG + Intronic
976555064 4:86441143-86441165 GCATTGCCAGATATAGGAAATGG + Intronic
978071394 4:104475968-104475990 GCAGTACCAGAAAGAGAACTGGG - Intronic
978781324 4:112558047-112558069 GCATAACCAGCAAGAGTACATGG + Intronic
983576109 4:169263578-169263600 GCATTGGCAGAAAGAATTGAAGG - Intronic
984012337 4:174385344-174385366 TCACTTCCTGAAAGAGTACATGG - Intergenic
986263778 5:6174895-6174917 TCATTTCCAGAAAGCGTGCAGGG + Intergenic
988371631 5:30376930-30376952 GCATTCTAAGAAATAGTACATGG + Intergenic
991569957 5:68043395-68043417 GGAAGGCCAGAAAGAGTCCAGGG + Intergenic
994098292 5:95867493-95867515 GCATTGTGAGAAAGAGTCAAGGG - Intergenic
998180848 5:139939850-139939872 GCAATGGCAAAAAAAGTACATGG + Intronic
998324234 5:141264902-141264924 CCATGGCTAGAAAGAGTTCAAGG + Intergenic
998553963 5:143105045-143105067 GCACTGAAAGAAAGAGTAAAGGG + Intronic
998707972 5:144786089-144786111 GCAATGCCAGAAAGGCTAAAAGG + Intergenic
998919742 5:147054958-147054980 GAATTGCCAGAATGTTTACAAGG + Intronic
998940664 5:147279512-147279534 CAATTGCAAGAAAGAGTTCAAGG + Intronic
1000684690 5:164233987-164234009 GCAAAGCCAGAAAAAGTACAGGG + Intergenic
1002368065 5:178729019-178729041 GGAGAGCCAGAAAGAGGACATGG - Exonic
1002385261 5:178861029-178861051 GGAGAGCCAGAAAGAGGACATGG + Exonic
1004984391 6:21064392-21064414 GCATTTCCAGAAAAAGAAAAGGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006299719 6:33187154-33187176 GCATTGCCACAAAGCGCAGAGGG - Intronic
1007052532 6:38846909-38846931 GCCCTGCCAGAAAGAGTATAAGG + Intronic
1009443853 6:63716063-63716085 TGATTGCCACAAAGATTACATGG - Intronic
1010136589 6:72561415-72561437 TCATTGCAAGAAAGAATTCAAGG - Intergenic
1013815418 6:114091918-114091940 GCATTGCCAGCAAATGTCCATGG - Intronic
1015275925 6:131383357-131383379 CCATTGCCATAAAGACTCCAAGG - Intergenic
1017188595 6:151627501-151627523 GAATTGACAGAAAGAATTCAAGG + Intergenic
1017564042 6:155665145-155665167 GCATTGCCAGAAATAGGAGCAGG - Intergenic
1019725192 7:2598204-2598226 GCACTGCCAGACAGAGTTAAGGG + Intronic
1020726925 7:11827521-11827543 GTATGGCCAGAAAAGGTACAAGG - Intronic
1021326239 7:19273055-19273077 CCATTGCAAGAAAGAATTCAAGG - Intergenic
1021455927 7:20829715-20829737 GGATGGGCAGAAAGAGTACTTGG + Intergenic
1023873612 7:44275520-44275542 GCATTGCCAGATAAAACACAGGG + Intronic
1025229862 7:57195734-57195756 CCATTGCCAGTAAGAGTCCTAGG - Intergenic
1026095533 7:67343523-67343545 GCATTGGCAGTAATAGGACATGG + Intergenic
1026548332 7:71344687-71344709 ACATTGCCAGAGAGAGAAGAGGG + Intronic
1030934432 7:115567598-115567620 GCATTGTCAGAAAGAGTGAGAGG - Intergenic
1031978987 7:128112298-128112320 GCTTTCCCATAAAGAGAACATGG + Intergenic
1032322461 7:130897606-130897628 GCATTGCCTGACAGAGACCAGGG - Intergenic
1032902236 7:136322382-136322404 GCATTGCATGAAAAATTACAAGG + Intergenic
1037479916 8:19294937-19294959 CCCTGGCCAGGAAGAGTACAGGG + Intergenic
1039569132 8:38573017-38573039 GCACTGACAGAAAGGGGACAAGG + Intergenic
1041490801 8:58430904-58430926 GCATTTGCAAAAAGAATACAGGG + Intronic
1046167034 8:110450406-110450428 TCATTGACATAGAGAGTACAAGG - Intergenic
1048730550 8:137435724-137435746 GCATGGGCAGAATGAGTACCGGG - Intergenic
1049192683 8:141297280-141297302 GCATTGCCAGGCAGAGTGCCCGG - Intronic
1055243295 9:74210818-74210840 TCATTGACATAAAGAGTAGAAGG - Intergenic
1055263627 9:74470088-74470110 GCATTGCCAGAAATAATTTAAGG - Intergenic
1057760783 9:97872815-97872837 GCATTGTAAGAAATAATACATGG - Intergenic
1061930839 9:133832318-133832340 GGAATGCCAGGAAGGGTACAGGG + Intronic
1203623157 Un_KI270749v1:139429-139451 GCAGGACCAGAAAGAGGACAGGG - Intergenic
1185881779 X:3747651-3747673 ACATTACCAGCAAGAGTGCATGG - Intergenic
1186604566 X:11076956-11076978 GCCTTTCCAGGAAGAGTAGATGG - Intergenic
1186838024 X:13457284-13457306 ACATTCCAAGAAAAAGTACAGGG - Intergenic
1189714681 X:43853335-43853357 GCATGGCCAGAAAAAAAACAGGG - Intronic
1191634938 X:63365470-63365492 GCATTTCCTGAAAGAGCATATGG - Intergenic
1193520078 X:82518951-82518973 GCATTGCCTAAAAGGGGACAAGG - Intergenic
1195034994 X:100964346-100964368 GCATTGCTATAAAGAAAACATGG + Intergenic
1195411909 X:104576871-104576893 CCTGTGCCAGAAACAGTACATGG + Intronic
1195676924 X:107513580-107513602 GCAGTCAAAGAAAGAGTACAGGG - Intergenic
1199690378 X:150305012-150305034 GCATAGCCTGAAAAAGCACAGGG + Intergenic
1201499733 Y:14628743-14628765 GCACTGACAGAAAGAGCACGTGG - Intronic