ID: 1117834430

View in Genome Browser
Species Human (GRCh38)
Location 14:59787629-59787651
Sequence CCTCATAGGGAGAAAATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117834424_1117834430 3 Left 1117834424 14:59787603-59787625 CCATGAATGTGATAAAATTGTGT 0: 1
1: 0
2: 1
3: 32
4: 294
Right 1117834430 14:59787629-59787651 CCTCATAGGGAGAAAATGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117834430 Original CRISPR CCTCATAGGGAGAAAATGGT GGG Intronic
903672353 1:25044043-25044065 TCAAATAGGGAGAAAATGGAAGG + Intergenic
905373529 1:37501634-37501656 GCTCAAAGGGAGGAATTGGTGGG - Intronic
905921773 1:41724342-41724364 CCCCTTAGGGAGAAAAGGGCTGG + Intronic
909687151 1:78362537-78362559 CCTCATAGGAAGAAAAAATTTGG + Intronic
913547538 1:119884428-119884450 GCTTAATGGGAGAAAATGGTTGG - Intergenic
914221481 1:145686134-145686156 CCTCTTAGGGTGAAAATGAAGGG - Intronic
914238419 1:145833561-145833583 CCTCATTGGAAGACAATGGCTGG - Exonic
914474045 1:148009003-148009025 CCTCTTAGGGTGAAAATGAAGGG - Intergenic
914846063 1:151283971-151283993 ACTCATGGGGAGACACTGGTAGG + Intronic
916330221 1:163607740-163607762 TCTCATGGGGAGAAAATGTGTGG + Intergenic
917287542 1:173436861-173436883 CTTGATAGGGATAAAATGATAGG + Intergenic
917448129 1:175123926-175123948 CTTGCTATGGAGAAAATGGTTGG + Intronic
917772347 1:178293548-178293570 CTTAATAGGGAGAAAAGGGATGG - Intronic
917831873 1:178898932-178898954 TCTCAAAGTGAGAAAAAGGTTGG + Intronic
918064595 1:181090430-181090452 CTTCATTGGGAGAGAAAGGTGGG - Exonic
920686092 1:208110079-208110101 CCTCACAGGGAGAGAAATGTGGG + Intronic
920762930 1:208803269-208803291 AGACAGAGGGAGAAAATGGTAGG + Intergenic
921838496 1:219802848-219802870 CCTCATTGGGAGAACATGAAAGG - Intronic
924410142 1:243795913-243795935 GCACATAGGGAGAAAATCGTAGG + Intronic
1063429207 10:5975072-5975094 TCTCATGGGTAGAGAATGGTTGG - Intronic
1063600648 10:7477686-7477708 CCTCACACGGTGAAAAGGGTGGG - Intergenic
1064164325 10:12973523-12973545 CCACGTAGGAAGAACATGGTTGG - Intronic
1066525889 10:36279238-36279260 CCTCAGAGGAACAAAATGGTGGG + Intergenic
1069208746 10:65728987-65729009 TGTTATGGGGAGAAAATGGTTGG + Intergenic
1069549146 10:69350283-69350305 CCTCATAGGTGAAAAATGGGAGG + Intronic
1076098361 10:127753013-127753035 CCTCTCAGGGACAGAATGGTGGG - Intergenic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1077826267 11:5811800-5811822 CCTCACAGGCAGCAAATAGTTGG - Intronic
1078492067 11:11778804-11778826 CCTCATAGAAAGGAAATGGGTGG - Intergenic
1079004081 11:16780306-16780328 CCACATGGGGAGAACTTGGTAGG + Intronic
1081821864 11:46005697-46005719 GCTCATAGGGAGTAAGTAGTTGG - Intronic
1083170858 11:60923502-60923524 CCCCACAGGGAGAAATTGGGAGG - Intergenic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1090124114 11:124068005-124068027 TCTCATTGAGAGATAATGGTGGG + Intergenic
1091589771 12:1836243-1836265 CCTCAGAGTGTGAAGATGGTGGG + Exonic
1094352243 12:29540069-29540091 CATCATAGGAAAAATATGGTAGG + Intronic
1094428952 12:30345749-30345771 CCTGATAAGGAGCAACTGGTTGG + Intergenic
1096770428 12:53932909-53932931 CCTAAAAGGGAGATAATGGAAGG - Intergenic
1099925968 12:89017650-89017672 ACGCACAGTGAGAAAATGGTAGG - Intergenic
1100401339 12:94232859-94232881 GCTCAGAGAGAGCAAATGGTAGG + Intronic
1100939702 12:99712741-99712763 TCTCATTGGGAGAAAATAGAAGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1105577180 13:21664745-21664767 CTTCACAGGGAGAACCTGGTAGG + Intergenic
1106213141 13:27669370-27669392 CCTCATAGGGAGAATATTTATGG - Intergenic
1107209959 13:37841239-37841261 GCTAATAGGGAAAAGATGGTTGG + Intronic
1108636094 13:52335820-52335842 CTTCATAGGGAGGAATGGGTTGG - Intergenic
1108651717 13:52487430-52487452 CTTCATAGGGAGGAATGGGTTGG + Intergenic
1108776585 13:53772336-53772358 CCTCTTAGGGAGAAAAGAGTTGG - Intergenic
1109259672 13:60129238-60129260 CCTCATAGAGGCAAAAAGGTTGG - Intronic
1111050592 13:82878972-82878994 GGTCATAGAGAGCAAATGGTGGG - Intergenic
1112497064 13:99913768-99913790 CCTCAGAGGGAGCAAGTGCTGGG + Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1116467945 14:45254667-45254689 CACCATAATGAGAAAATGGTTGG + Intergenic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1117834430 14:59787629-59787651 CCTCATAGGGAGAAAATGGTGGG + Intronic
1120452812 14:84691574-84691596 ACACATTGGGAGAAAATGTTAGG - Intergenic
1121257004 14:92538340-92538362 CTTTATAGGTAAAAAATGGTTGG + Intronic
1121329787 14:93042658-93042680 GCTCAGAGGGAGAAACTGGTGGG + Intronic
1121947512 14:98137201-98137223 GCTCATGGAAAGAAAATGGTGGG + Intergenic
1124878753 15:33622067-33622089 AGTCAGAGGGAGATAATGGTGGG - Intronic
1127372922 15:58357105-58357127 CCTCCTAGGAAGAGAAAGGTGGG + Intronic
1133094634 16:3434291-3434313 CCTCAGTGGGAGAAACTGGCAGG - Exonic
1133286516 16:4693306-4693328 CCTCCTGGGGAGAAACGGGTGGG + Intergenic
1134458776 16:14414014-14414036 CCTCTCAGGGAGAAAAAGCTGGG + Intergenic
1136078843 16:27838502-27838524 CACCATAGGGAGAAAAGGGGAGG + Intronic
1137501969 16:49018798-49018820 CCTCATAGGGAAGAAATGTTTGG - Intergenic
1138610572 16:58120450-58120472 TCTCACAGGGAGAAAATGTTAGG + Intronic
1140198599 16:72876474-72876496 CCTCGTGGGGAGGAAGTGGTTGG - Intronic
1143136040 17:4712864-4712886 TCACAGAGGGAGTAAATGGTGGG - Intronic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1144243699 17:13340808-13340830 CCTCATATGGCGGAAATGGAAGG - Intergenic
1149603818 17:57910984-57911006 TGGCATAGGGAGAAAATGGGAGG - Intronic
1150563371 17:66315301-66315323 CCACATAGTTAGAAAATGGTGGG + Intronic
1152128625 17:78462363-78462385 CCTCACAGGGTGTCAATGGTGGG + Intronic
1156579557 18:38359215-38359237 CCTGATAGAGAAAAAGTGGTAGG + Intergenic
1158423550 18:57318316-57318338 ACACATAGGGAGAAAATGAAGGG - Intergenic
1160073616 18:75650702-75650724 GCTCATCAGGATAAAATGGTAGG - Intergenic
1160564912 18:79781037-79781059 CTTCATAGGGAGAAAAAGGAGGG - Intergenic
1160819241 19:1050007-1050029 GCTCACAGGGAGGAAGTGGTGGG - Intronic
1164486981 19:28666922-28666944 CCTTATGGGGACAAAATGGAAGG - Intergenic
1166863134 19:45821133-45821155 CATCAGAGGCAGAAAAAGGTGGG + Intronic
1168134652 19:54342237-54342259 CCTGAGGGGGATAAAATGGTGGG - Intergenic
925526213 2:4805212-4805234 CCTCACTGGGAGAGAATGCTTGG - Intergenic
927018481 2:18993544-18993566 CCTCATTTGGAGAACAGGGTCGG + Intergenic
929382992 2:41374808-41374830 CCTCAGAAGGTGAAAATTGTGGG - Intergenic
931229220 2:60360058-60360080 CCTCATAGGCAGAAACTTGGGGG - Intergenic
932084387 2:68745407-68745429 ACTGATAGTGAAAAAATGGTGGG - Intronic
934158236 2:89222985-89223007 CCTCATAGGGAAAATAATGTGGG + Intergenic
934209028 2:89959439-89959461 CCTCATAGGGAAAATAATGTGGG - Intergenic
936682511 2:114790573-114790595 CCGCAAAGGGAGATAAAGGTGGG + Intronic
937105850 2:119312010-119312032 CCTCATTGGTAGAAAAGGGGAGG + Intronic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943979913 2:194536123-194536145 TCTCATTGGGAGGAGATGGTTGG + Intergenic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
946089561 2:217208633-217208655 CCTCAGAAGGATAGAATGGTGGG - Intergenic
948110164 2:235448524-235448546 CCACATTGTGGGAAAATGGTGGG - Intergenic
948795138 2:240398826-240398848 GCTCAGAGGGAGAAAATGAGGGG - Intergenic
1169501079 20:6161281-6161303 TCTCAAAAGGAGAACATGGTAGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170415233 20:16132745-16132767 TCTTATAGGGAGAAAATTGAGGG - Intergenic
1170854649 20:20039965-20039987 CCACAGAGGGAAAGAATGGTAGG - Intronic
1171363979 20:24611184-24611206 CTTCATAGAGAGAGAATGTTTGG - Intronic
1172886129 20:38232026-38232048 CCTCATGGGGAGGAAAGGGGAGG + Intronic
1173351457 20:42249302-42249324 CTTTATAGGGAACAAATGGTAGG + Intronic
1174409181 20:50322450-50322472 CCACAGAGGCAGAACATGGTAGG + Intergenic
1175157043 20:56978208-56978230 CCACATTGGGAGAGAATGGGGGG - Intergenic
1180295298 22:10928871-10928893 CCTAATAGGGAAAAAAGGGGGGG - Intergenic
1181337976 22:22155176-22155198 CATCATGGGGAGATGATGGTGGG + Intergenic
1182174074 22:28265281-28265303 TCACATAGGCAGAAAATCGTGGG - Intronic
1184322872 22:43756500-43756522 CCTCCTTGGGACAAACTGGTAGG + Intronic
950714600 3:14838776-14838798 CCAAACAGGGAGAAAATGGAAGG + Intronic
951583929 3:24195878-24195900 GATGATAGAGAGAAAATGGTTGG - Intronic
951689011 3:25375892-25375914 CCACATAGCTAGTAAATGGTAGG - Intronic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
959926438 3:111926690-111926712 CTTCAGAGGCAGAGAATGGTTGG + Intronic
962183149 3:133229736-133229758 CCTCATGAAGAGGAAATGGTAGG + Intronic
964220414 3:154338172-154338194 CCTCATAGGTAGAAAGAGATAGG + Exonic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
966034211 3:175390969-175390991 CCTCATTGGGACATAATTGTGGG - Intronic
966669340 3:182509321-182509343 CCACTTAGGAAGAAAATTGTGGG + Intergenic
966859134 3:184218999-184219021 ACTCATAGGGAGAAGCAGGTGGG + Intronic
974649659 4:64738154-64738176 CATCAAAGGGAGATAAGGGTGGG - Intergenic
976991152 4:91368146-91368168 CATCCTAGGGAGAAAATAGAAGG - Intronic
978362194 4:107942727-107942749 CTACATAGGGAAAAAATGTTTGG + Intronic
978470331 4:109059287-109059309 GCACATAGGTAGTAAATGGTGGG + Intronic
980141493 4:128923048-128923070 CCTCATTGGGATATAATTGTGGG + Intronic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
982228105 4:153183968-153183990 CCTCATAGGGATTAAATGGGAGG + Intronic
983499524 4:168483218-168483240 TCACAAAGGGAGAAAATGGAAGG - Intronic
984035427 4:174661793-174661815 CCTCAAAGGTAGAAAAGGGAAGG + Intronic
987217502 5:15752431-15752453 TTTCATGGGGAGAAAATGTTGGG + Intronic
987778853 5:22405583-22405605 CCTAAGAAAGAGAAAATGGTAGG + Intronic
991555219 5:67888110-67888132 GCTTATAGGGAGGAAATGTTTGG - Intergenic
993425779 5:87762641-87762663 CCTCATAGGGAGCAAATACTGGG + Intergenic
993744556 5:91580883-91580905 ACCCAGAGGGAGAAAATGGCAGG + Intergenic
994775208 5:104030978-104031000 CTTCAGAGGGAGAATATGATAGG + Intergenic
997531265 5:134582694-134582716 CCTCTGAGGGAGAAAGTGGCAGG - Exonic
998866678 5:146511732-146511754 CCTCATAGCAAGAAGATGCTGGG + Exonic
1002822978 6:745586-745608 CCTCAAAGTTAGAAAATGGCAGG + Intergenic
1002959896 6:1904924-1904946 CTTAAAAGGGAGATAATGGTAGG + Intronic
1005486975 6:26309803-26309825 TCTCATAGGGAGAAAAATGCAGG + Intergenic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1009377689 6:62992037-62992059 CGTCATGGGAAGAAACTGGTGGG - Intergenic
1014723639 6:124949937-124949959 GCACATTGGGAGAAGATGGTGGG + Intergenic
1016921932 6:149304174-149304196 CCTCATTGGGAGAAAGTTGGTGG - Intronic
1022549189 7:31221000-31221022 TCTCATACTGAGAAAAAGGTGGG - Intergenic
1022709649 7:32838845-32838867 CAGCATAGGGAGATAAGGGTGGG + Intergenic
1022710355 7:32843202-32843224 CAGCATAGGGAGATAAGGGTGGG + Intergenic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1027758683 7:82249581-82249603 CCTCATAGTTACAAAATGGTTGG + Intronic
1028880981 7:95879829-95879851 CCTAATAGAGAGAGAATTGTAGG + Intronic
1031412272 7:121454301-121454323 TCTTATAGGGAGAAGATAGTTGG + Intergenic
1035264069 7:157680082-157680104 CCTCGGAGAGAGAGAATGGTAGG - Intronic
1036026019 8:4909888-4909910 CCTCATAAGAAGAAAAAGCTGGG - Intronic
1040949819 8:52926104-52926126 CTTCATAGTGAGAACCTGGTGGG + Intergenic
1044791123 8:95848274-95848296 TCTCATACAGAGAAAATGGCAGG - Intergenic
1049941826 9:553364-553386 CATCATAGGGAGAAAATCAAAGG - Intronic
1050601674 9:7259090-7259112 CCACATAGATAGAAAGTGGTAGG - Intergenic
1050788884 9:9441034-9441056 CCTCATTGGGCCAAAATGGCTGG + Intronic
1051135009 9:13910216-13910238 CTTCAGCGGGAGAAAAAGGTTGG + Intergenic
1051434099 9:17012772-17012794 CAACTCAGGGAGAAAATGGTGGG - Intergenic
1052537110 9:29761434-29761456 GCTTTTAGGGAGAAAATGGTGGG + Intergenic
1052787130 9:32839177-32839199 CCCGATAGGGAGAAAATGACTGG + Intergenic
1052949712 9:34198701-34198723 CCTCATAGGGAAGAAATGGGAGG - Intronic
1053314944 9:37043141-37043163 GCTCGGAGGGAGAAAATGCTTGG + Intergenic
1055218881 9:73903630-73903652 CCTCACAGTGAGAAATTTGTTGG - Intergenic
1055271470 9:74564497-74564519 CCCAAATGGGAGAAAATGGTGGG - Intronic
1056044348 9:82701665-82701687 CAGCATAGGGAGATAAGGGTGGG + Intergenic
1056045042 9:82705950-82705972 CAGCATAGGGAGATAAGGGTGGG + Intergenic
1056140980 9:83679200-83679222 CCTAATAGGGTTAAAATGGAGGG - Intronic
1060593112 9:124831809-124831831 CCTCAGCGTGAGAAAATGGAAGG + Intergenic
1185996387 X:4954620-4954642 CATCTTAAGGAAAAAATGGTTGG + Intergenic
1187620391 X:21046976-21046998 ACTCACAGGGAGGAAATGTTAGG - Intergenic
1187973589 X:24683089-24683111 CCTCACAGTGAGAATCTGGTGGG - Intergenic
1188901051 X:35733673-35733695 CATCTTAGGGAGAATATGGGTGG + Intergenic
1188986177 X:36770307-36770329 TTTCATAGGGATAAAATGGCAGG - Intergenic
1189669421 X:43392134-43392156 CTTCATAGGGAGAGAAAAGTTGG - Intergenic
1191901590 X:66046307-66046329 CCTCATAGGGTGAAGAAGGTAGG + Intergenic
1192072719 X:67958201-67958223 CCTCTCAAGGAGGAAATGGTTGG + Intergenic
1193329836 X:80223644-80223666 CCTAATTGGGAGAAAGTGGGAGG - Intergenic
1197034375 X:121856015-121856037 CTTCACAGTGAGAACATGGTAGG + Intergenic
1197190165 X:123638193-123638215 CATCATAGGGGCAAAATTGTTGG + Intronic
1198793141 X:140367610-140367632 TCCCATAGAGAGAATATGGTAGG + Intergenic