ID: 1117834677

View in Genome Browser
Species Human (GRCh38)
Location 14:59791385-59791407
Sequence GCTGGGACTTTAAGCAGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117834676_1117834677 -8 Left 1117834676 14:59791370-59791392 CCAGGGATGAGTTCAGCTGGGAC 0: 1
1: 0
2: 1
3: 21
4: 168
Right 1117834677 14:59791385-59791407 GCTGGGACTTTAAGCAGTTACGG 0: 1
1: 0
2: 1
3: 11
4: 95
1117834673_1117834677 -5 Left 1117834673 14:59791367-59791389 CCTCCAGGGATGAGTTCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1117834677 14:59791385-59791407 GCTGGGACTTTAAGCAGTTACGG 0: 1
1: 0
2: 1
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117834677 Original CRISPR GCTGGGACTTTAAGCAGTTA CGG Intronic
907267295 1:53270567-53270589 GCAGGGACTTAAAGCAGGAATGG + Intronic
910235350 1:85030122-85030144 GCTGGGTCTTGCAGCCGTTAGGG - Intronic
912944678 1:114075132-114075154 GCTAGCATTTTAAGCAGTAATGG + Intergenic
917874053 1:179269412-179269434 TCTGGGACTTGGAGCAGCTAGGG + Intergenic
919123771 1:193372332-193372354 ACAGGGACTTGAAGAAGTTAAGG - Intergenic
921262882 1:213399515-213399537 TCAGGGAGTTTAAGCAGTTTTGG - Intergenic
1064278341 10:13928279-13928301 GCTGGGCCTTTCAGCACTTTGGG - Intronic
1068892785 10:62165114-62165136 GCTGGGCCTTGAAGCAGGTAGGG - Intergenic
1071517323 10:86306780-86306802 TCTGGAACTTTTAGCTGTTAGGG - Intronic
1072442218 10:95467320-95467342 GCTGGGGTTTTCAGCAGTTAGGG + Intronic
1073121127 10:101123186-101123208 GCTGGGAATTAGACCAGTTAGGG - Intronic
1073673470 10:105618405-105618427 TCTGGGACTTTAAGCAACAAAGG - Intergenic
1074792786 10:116908098-116908120 TCTGTAACTTCAAGCAGTTAGGG - Intronic
1079112017 11:17610360-17610382 GCTGGGACTTGAAGCACTCTGGG - Exonic
1081494604 11:43596139-43596161 GCTGGGACTTTGGGAAGCTAAGG - Intronic
1081690768 11:45076278-45076300 GCTGGAACTTTATGGAGTTCTGG - Intergenic
1083033424 11:59615241-59615263 GCTGGGACTGTTGGCAGATATGG + Intronic
1085665848 11:78415613-78415635 GCTGTTACTTAAAGCTGTTAAGG + Intronic
1088013654 11:105034202-105034224 GCTGGGACTCTCAGCAGGTAAGG - Exonic
1088014659 11:105044386-105044408 GCTGGGACTCTCAGCAGGTAAGG - Exonic
1088016777 11:105070598-105070620 GCTGGGACTCTCAGCAGGTAAGG - Intronic
1088019325 11:105100507-105100529 GCTGGGACTCTCAGCAGGTAAGG - Exonic
1089896131 11:121931981-121932003 GCTGGGACTGTAAGCTATTCAGG - Intergenic
1093148701 12:15597026-15597048 GCTGGGAATTTATGAAGTTATGG + Exonic
1094428138 12:30337165-30337187 GCTGGGATTTTTAGGATTTAAGG - Intergenic
1095255323 12:40028481-40028503 GTTGGGACTTGCAGCAGTTCCGG - Exonic
1106926109 13:34614839-34614861 GTTCGGACTTTAAGCAGATAAGG - Intergenic
1108808521 13:54189777-54189799 GCTGAGACATTAAGCAGGAATGG - Intergenic
1114289829 14:21278591-21278613 GCTGGGCTTTTATGCACTTAAGG - Intergenic
1115724769 14:36201192-36201214 AGTGGGACCTTAAGGAGTTATGG - Intergenic
1117834677 14:59791385-59791407 GCTGGGACTTTAAGCAGTTACGG + Intronic
1118649747 14:67877922-67877944 GCTTGGAATTCAAGCAGTTTGGG - Intronic
1119532250 14:75370574-75370596 GATTAGACTTTATGCAGTTATGG - Intergenic
1119710453 14:76818392-76818414 GGTGGGTCTGAAAGCAGTTAGGG - Intronic
1119865864 14:77973379-77973401 GCTGGCACTGTAAGCAGTAGAGG - Intergenic
1122124007 14:99569462-99569484 CCTGGGGATCTAAGCAGTTACGG + Intronic
1125481129 15:40081656-40081678 GCGAGGACTTTAAGAAGTTTTGG - Intergenic
1126421244 15:48475247-48475269 GCTAGGACTCTAAGAAGCTAGGG - Intronic
1128483672 15:68063151-68063173 GCAGGGTCTTTATGCAGTTCTGG + Intronic
1132464287 16:70672-70694 CCTGGGACCTTAGGCAGTGATGG - Intronic
1132969201 16:2677153-2677175 TTTGGGACTTTCAGCAGTTCTGG - Intergenic
1133715083 16:8440105-8440127 GATGGGGCTTTAAGCAATTCTGG + Intergenic
1137037575 16:35579467-35579489 GATGGGACTTTGAGCTGTTAGGG - Intergenic
1137406728 16:48194976-48194998 GCTGGGATTTGAAGCAGTTAAGG + Intronic
1138620922 16:58210719-58210741 GCTGAGACTTGAAGAAGTGAAGG + Intergenic
1139194020 16:64897273-64897295 GCTGAGACTTTAAGGAGGAATGG + Intergenic
1151129700 17:71883584-71883606 AATGAGACTTTAGGCAGTTAAGG + Intergenic
1152420762 17:80191835-80191857 GCTGGGCTTTTAAGCATTTCAGG - Intronic
1153379790 18:4425507-4425529 TCTGGGTCTTTAGGCAGATATGG - Intronic
1156894805 18:42233640-42233662 ACTAATACTTTAAGCAGTTAAGG - Intergenic
1158971638 18:62673708-62673730 CCTTGGAGTTTAAGGAGTTAAGG - Intergenic
929054163 2:37861859-37861881 GCTGGCACTTTAAGCAATGGAGG - Intergenic
929329536 2:40664114-40664136 GCTGGGACCTTTAACAGTTGGGG + Intergenic
930611328 2:53547330-53547352 GCTAGGACTTGAGGCAGTGAGGG - Intronic
932743686 2:74313501-74313523 GCTGGGACTTTAGACAGATTTGG - Intronic
932799988 2:74732991-74733013 TCTGGGATTGTTAGCAGTTAGGG + Intergenic
935875391 2:107500997-107501019 GCAGTGACTTTAAGCAGCCATGG - Intergenic
936856062 2:116958501-116958523 GCTGGGATTTTAGGCAGGAAGGG + Intergenic
937077627 2:119118372-119118394 GCTGGGACCTCAGGCAGGTAAGG - Intergenic
939693968 2:145300938-145300960 ACTTGGACTTAAACCAGTTAAGG + Intergenic
943166486 2:184332867-184332889 GGTCACACTTTAAGCAGTTAAGG - Intergenic
947299407 2:228672102-228672124 GCTGGGACTTCAATCTGTTGAGG - Intergenic
1169577966 20:6986998-6987020 ACTGGGCCTTTAAACATTTAGGG + Intergenic
1174865404 20:54130908-54130930 GCTGGGACTCTGAGCAGTACAGG - Intergenic
1177166162 21:17606512-17606534 TCTGGGACCAAAAGCAGTTAAGG + Intronic
1179269560 21:39840325-39840347 GCTGGGACTTTGTGCAGCTTGGG + Intergenic
1184811346 22:46834651-46834673 GCTGGGACTGTCAGTAGTCAGGG + Intronic
950049808 3:9979021-9979043 GCTGAGACTTGAAGATGTTAAGG - Intronic
952713871 3:36458490-36458512 GCTGGGAAGTTAAGCAGACATGG - Intronic
953160425 3:40414723-40414745 GCTGGGACTTGAAGTAGCTTTGG - Exonic
954787851 3:53108004-53108026 GCTGGAACTGTTAGCAGTGAGGG - Intronic
955649743 3:61181189-61181211 GCTGGGATTTTATCCAGTTTGGG - Intronic
955711755 3:61786869-61786891 TCTTTGTCTTTAAGCAGTTATGG - Intronic
956756344 3:72391537-72391559 GCTGGGTCTTAAAGCAGGTATGG - Intronic
956905382 3:73760084-73760106 GTTGGGAGTATAAGCTGTTATGG + Intergenic
958920869 3:100104003-100104025 TCTGGGCCTTTAAGCAAATAAGG - Intronic
961199970 3:125037874-125037896 GCTGGGGCATGAAGCAATTAAGG - Intronic
962334074 3:134510404-134510426 GCATGGACTGTAAGCAGGTATGG + Intronic
965965361 3:174482280-174482302 GCTGGGCCTTTCTGCAGTAAGGG - Intronic
968815621 4:2820216-2820238 ACTGGGACTTGAAGTAGTTATGG + Intronic
973727316 4:53789457-53789479 GCTGAGAATTAAAGCAGTGAGGG - Intronic
976900605 4:90170080-90170102 GCTGGGACTTTAAGAACATTTGG - Intronic
979745915 4:124212759-124212781 GTTGAGACTATAAGCAGTAAAGG - Intergenic
986460190 5:7962404-7962426 TCTGAGGCTTCAAGCAGTTATGG - Intergenic
992307168 5:75453366-75453388 TCTGAGTCTTTAAGAAGTTATGG + Intronic
995820279 5:116222105-116222127 TCTGGGATGTTAAGAAGTTAGGG + Intronic
997305521 5:132832996-132833018 GCTGGGCCTTTCAGATGTTAGGG - Intergenic
997623882 5:135318788-135318810 GCTGAGGCTTTGAGCATTTAAGG - Intronic
998019238 5:138755644-138755666 GCTTGGACTTTTAGCACATAAGG - Intronic
1001576563 5:172768612-172768634 TCTGGGTTTCTAAGCAGTTATGG - Exonic
1004153636 6:13146650-13146672 GCTGGGATATTAAGCCGTTCTGG + Intronic
1005481763 6:26261634-26261656 GTTTGGACTTTAGGCAGATAAGG - Intergenic
1006416034 6:33904436-33904458 GCTGGAGGTTTGAGCAGTTAGGG + Intergenic
1011277566 6:85644231-85644253 CCTGGCCTTTTAAGCAGTTAAGG + Intergenic
1011465843 6:87656093-87656115 GCTGTACATTTAAGCAGTTATGG + Intronic
1014266135 6:119279787-119279809 TCAAGGTCTTTAAGCAGTTAGGG - Intronic
1015764273 6:136699439-136699461 GATGGGGCTTTAAGCAGCTGTGG - Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1024674204 7:51623608-51623630 GCTGAGACCCAAAGCAGTTAAGG + Intergenic
1032368349 7:131322206-131322228 GCAGGCAGTTTAAGCATTTAAGG + Intronic
1032876557 7:136044751-136044773 GCTGGCAGTTTCAGCAGTGATGG + Intergenic
1033341973 7:140499195-140499217 GCTGGGACTTTAGCCAGGTGTGG - Intergenic
1034432255 7:151046942-151046964 GCTGTGTCTTTAAGCAGTGGAGG + Intronic
1042951703 8:74206809-74206831 GCTGGGACTCAAATCATTTAAGG - Intergenic
1046977198 8:120293549-120293571 ACTGAGACTTTAAGAAGCTAGGG + Intronic
1185546642 X:951034-951056 GCTGGGATTACAAGCAGGTATGG + Intergenic
1196657074 X:118229432-118229454 GCTGGGCCTCTAAGCAATAAAGG + Intergenic
1198200517 X:134412248-134412270 GGTGGGACTTGAGGGAGTTAAGG - Intronic