ID: 1117834874

View in Genome Browser
Species Human (GRCh38)
Location 14:59793415-59793437
Sequence CTTCTGTACTTAAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117834874_1117834878 20 Left 1117834874 14:59793415-59793437 CCTTTTTTTCTTAAGTACAGAAG 0: 1
1: 0
2: 4
3: 41
4: 446
Right 1117834878 14:59793458-59793480 TAAAATCAAAACAAGAGCAATGG 0: 1
1: 1
2: 5
3: 81
4: 849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117834874 Original CRISPR CTTCTGTACTTAAGAAAAAA AGG (reversed) Intronic
901523563 1:9804538-9804560 CTTCTCCACTTAAGAAAGCAAGG + Intronic
901977577 1:13007368-13007390 CTTCTCTCCTTATCAAAAAACGG + Intronic
902004508 1:13221567-13221589 CTTCTCTCCTTATCAAAAAACGG - Intergenic
903220557 1:21867073-21867095 CATCTCTATTTAAAAAAAAAAGG - Intronic
905634865 1:39543658-39543680 CATGAATACTTAAGAAAAAAAGG + Intergenic
905837965 1:41145442-41145464 CTACAGTACTTAAGACATAATGG - Intronic
907209460 1:52807169-52807191 AGTCTCTACTTAAAAAAAAAAGG - Intronic
907651658 1:56300652-56300674 CTTGTGTAATGAAGTAAAAAAGG - Intergenic
908307926 1:62843456-62843478 ATTCAGTTTTTAAGAAAAAAAGG - Intronic
910666034 1:89726765-89726787 CATCTGAACTTCAGAGAAAAGGG - Intronic
911249173 1:95555783-95555805 CTTCTGTCAGTAACAAAAAAAGG - Intergenic
911328691 1:96499805-96499827 CTTCTTTACTAAAGCAAAACTGG + Intergenic
911484253 1:98485841-98485863 CTTCTGTATTTAAAAAAAAAAGG + Intergenic
911595099 1:99790744-99790766 CTTCAGTACTGCAGAAACAATGG + Intergenic
911876469 1:103170190-103170212 CTTCTGATTTTAATAAAAAATGG + Intergenic
912825834 1:112902342-112902364 CTTCTGTTTTTAGGAAAAATTGG + Intergenic
916756309 1:167773428-167773450 CTTCTGTATTTAATGAAAAAAGG + Intronic
916919833 1:169452868-169452890 CTTCAGGATTTAAGAGAAAAAGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917399345 1:174629876-174629898 CTTCCATATTTAAGAAATAAAGG - Intronic
917498229 1:175562222-175562244 CTTCAGTGCTGGAGAAAAAATGG - Intronic
917893113 1:179459076-179459098 TTTCTCTACTTAAGCAATAAAGG + Intronic
918330036 1:183450158-183450180 CGTCTATAATTTAGAAAAAAAGG - Intergenic
918710664 1:187725006-187725028 TTTATGGTCTTAAGAAAAAAAGG - Intergenic
918795218 1:188886063-188886085 ATACTGTACTTAAGATTAAATGG + Intergenic
919252262 1:195071615-195071637 CTTCTGTATTAAAGAGAAACTGG - Intergenic
919574286 1:199287515-199287537 CTTCTAAAATTTAGAAAAAAAGG + Intergenic
919980601 1:202640598-202640620 CCTCTGTGGTTATGAAAAAATGG - Intronic
920645194 1:207798013-207798035 CTCCTATACTTAAGCAATAAGGG - Intergenic
920735813 1:208532299-208532321 TTTTTGTACTTAGGAAAAGAGGG + Intergenic
920739645 1:208568470-208568492 CTTTTGTCCCTAAGAAAATATGG + Intergenic
921041300 1:211435295-211435317 CTTATTTACTGAAGAAATAAAGG + Intergenic
921059205 1:211568411-211568433 CTTATGTAATTAAAAATAAATGG + Intergenic
923198693 1:231691538-231691560 CTTCTGAAGTTAAAAGAAAAAGG - Intronic
923418217 1:233786238-233786260 CTTCTGTAGTTTAGTGAAAAAGG + Intergenic
924109845 1:240688011-240688033 CTACTGTCCTTCAGAGAAAAAGG - Intergenic
924353538 1:243144948-243144970 ATGCATTACTTAAGAAAAAATGG + Intronic
924874462 1:248086147-248086169 CTTCTGAATATATGAAAAAATGG - Intronic
1063773474 10:9231706-9231728 CTTCTGTACTTTGCAAATAAGGG - Intergenic
1063830267 10:9944330-9944352 ATTCTTTACTTAAGAAAAGGTGG - Intergenic
1064521345 10:16205719-16205741 CTTCTGTACTACAGAACAAATGG - Intergenic
1064959806 10:20951307-20951329 ATTCTGTACAAAAGAGAAAAAGG + Intronic
1065379007 10:25070032-25070054 CTTCTGTGATTATCAAAAAATGG + Intergenic
1066286674 10:33973861-33973883 CATCTGTATTTAAGGAAAAGAGG + Intergenic
1067901722 10:50248607-50248629 CTGCTGTACCTGAGAAGAAATGG - Exonic
1068572605 10:58646931-58646953 TTTCTGTTTTTAAGTAAAAATGG + Intronic
1068987362 10:63119731-63119753 CTTCTGCAACTCAGAAAAAATGG - Intergenic
1070277863 10:75024962-75024984 CTTTTGTACTAAAGAAGAAAAGG + Exonic
1070321354 10:75357116-75357138 CTCCTGTGCTTAAAAAAAAAAGG - Intergenic
1070324903 10:75382301-75382323 CTTCCTTACTAAGGAAAAAATGG + Intergenic
1070342184 10:75507821-75507843 CTTCTGTGCCTAAGGACAAATGG - Intronic
1070874258 10:79787567-79787589 CTCCTGGGCTTAAGAAAAGAAGG + Intergenic
1071009308 10:80919225-80919247 CTTGTCTACTTAAGAGAGAAGGG + Intergenic
1071529041 10:86375137-86375159 CTTCTGTGTGTAAGAAATAAAGG - Intergenic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1071641189 10:87309721-87309743 CTCCTGGGCTTAAGAAAAGAAGG + Intergenic
1072168632 10:92838688-92838710 CGACTGAACTTAAGAAAAAAGGG + Intronic
1072267236 10:93742445-93742467 TTTCTGTCCTTAGGAAAAAGGGG - Intergenic
1072894390 10:99353710-99353732 AGTCTGTACTTAAGAAGAAATGG + Intronic
1072919534 10:99564330-99564352 CTTTTGTAACTTAGAAAAAAAGG + Intergenic
1073313926 10:102564925-102564947 CTACTGCACTGAAGAAAAACAGG + Intronic
1073876358 10:107926589-107926611 CCTCTGAACTTAAAAAAAGAAGG + Intergenic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074156862 10:110807315-110807337 GTTCTGTGGTTAAGAAAATAAGG + Intronic
1075248301 10:120844559-120844581 GTTCTATCCCTAAGAAAAAAAGG + Intergenic
1075908081 10:126099977-126099999 CTTTTATACTTAAAAAAAAAAGG - Intronic
1075908207 10:126101035-126101057 CTTGTCTGCTTAAAAAAAAAAGG - Intronic
1077940875 11:6841207-6841229 CTTTTGTACTTCAGAATAAACGG - Intergenic
1078022696 11:7668785-7668807 CTTCTGTTCTGAGGAAAAAGAGG + Intronic
1078914940 11:15770351-15770373 CTTCTGTAATCATGAAAAATGGG + Intergenic
1080385499 11:31808638-31808660 CTACTGAATTTAAAAAAAAATGG - Intronic
1081038619 11:38181846-38181868 CCTCTGTACTTAGGAATAAAAGG + Intergenic
1082636020 11:55595398-55595420 AATCTGTTCTTCAGAAAAAAAGG - Intergenic
1082643616 11:55694147-55694169 CATCTTTACTCAAGGAAAAAAGG - Intergenic
1087672198 11:101121009-101121031 CTACTGTACTGAAAAAGAAATGG - Intronic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1090149701 11:124370047-124370069 CTTATGTAATTAAAAGAAAAAGG + Intergenic
1092287670 12:7138263-7138285 CTTCTGGATTTAAAAAAAAAAGG + Intronic
1092747289 12:11685741-11685763 TTTCTGTAATAAAGATAAAATGG + Intronic
1093318628 12:17683854-17683876 CCTCTGTATGTAAGAAAAATGGG + Intergenic
1093484700 12:19640516-19640538 CTTGTGTCATTAAGAAAAATGGG + Intronic
1094095139 12:26695301-26695323 CTTCTTTACAGAAGAAAAAAGGG + Intronic
1094353791 12:29556051-29556073 CTTCTAAACTTAAAAAAAAAAGG - Intronic
1094531809 12:31282865-31282887 CTTCTGTCTAAAAGAAAAAATGG + Exonic
1094606580 12:31954588-31954610 GTTCTGTACTTAAAAATAATAGG - Intergenic
1095381811 12:41604172-41604194 CTTCTCTGATAAAGAAAAAAAGG - Intergenic
1097994180 12:65869574-65869596 CTTATGTATTTAAGAAAGAATGG + Intronic
1098115205 12:67168539-67168561 TTGATGTACTCAAGAAAAAATGG + Intergenic
1098855785 12:75651748-75651770 TTTCTTTACTTAAGCCAAAAGGG + Intergenic
1100005252 12:89887891-89887913 CTTCTGTACTTGAGAACCAAAGG + Intergenic
1100400213 12:94222889-94222911 CTTCTGTTCTCAAGACAAAGAGG - Intronic
1100946655 12:99791403-99791425 AATCTGCACTTTAGAAAAAATGG + Intronic
1102499258 12:113340169-113340191 CTTATATACTTAAAAAAAAAAGG + Intronic
1102557645 12:113738361-113738383 CATCTCTACTAAAAAAAAAAAGG - Intergenic
1103646099 12:122393941-122393963 TTTATGTATTTAAGAAAATAGGG + Intronic
1104097889 12:125575995-125576017 CTTGTGTACTTCTGGAAAAAAGG + Intronic
1104152397 12:126096220-126096242 CTGCTGGACATAAGAAAAACAGG - Intergenic
1105727325 13:23177522-23177544 TTTCTATACTTAAAAAAAAACGG - Intergenic
1106044559 13:26126557-26126579 ATTATGTACTTATGAAAGAATGG - Intergenic
1106495676 13:30272096-30272118 TTCTTGTAATTAAGAAAAAAGGG + Intronic
1107504021 13:41012427-41012449 GTTTTGTTTTTAAGAAAAAAAGG + Intronic
1108782761 13:53856829-53856851 CTATTGTATTTCAGAAAAAAAGG - Intergenic
1108850483 13:54722009-54722031 TTTCAATACTTCAGAAAAAAGGG + Intergenic
1109105842 13:58249815-58249837 CTTCCTTGCTGAAGAAAAAAAGG + Intergenic
1109251178 13:60022637-60022659 CTTGTGTCCTTAAAAGAAAAAGG - Intronic
1109311073 13:60694139-60694161 CTTCTGTATTTTCGAAGAAAAGG - Intergenic
1109623828 13:64947630-64947652 CTTGGGTACGCAAGAAAAAATGG - Intergenic
1109637760 13:65145308-65145330 TTTGTGTACTAAAGAAAGAAAGG + Intergenic
1110214504 13:73011125-73011147 CTTATGTATTTAAGAAAAGTTGG - Intronic
1110246334 13:73328479-73328501 CTGCTTTACAAAAGAAAAAAAGG + Intergenic
1110591178 13:77261376-77261398 CTTATGTATTAAAAAAAAAAAGG + Intronic
1110707795 13:78614568-78614590 TTTCCATACTTAAGAAAAAGAGG - Exonic
1111384981 13:87513480-87513502 CTTCTCTCCTTTAGAAAAGAAGG + Intergenic
1111455078 13:88471694-88471716 TTTTTGAAATTAAGAAAAAATGG + Intergenic
1111619936 13:90712231-90712253 CTTCTTTGCTTAAAAAACAAGGG - Intergenic
1111713395 13:91846618-91846640 CTTTTTTACTGAAGACAAAAAGG + Intronic
1112017863 13:95346295-95346317 CTTCTCAAGTAAAGAAAAAAAGG + Intergenic
1112080951 13:95969654-95969676 CTTCTCTGCTTAAGCAAGAAAGG + Intronic
1112586324 13:100721943-100721965 CTTATGAAGTTAACAAAAAAGGG + Intergenic
1112717915 13:102207590-102207612 CATCTGTCCTTGAGAAAAAAGGG + Intronic
1112941682 13:104870351-104870373 CTTGTGTAATTGAGAAAAACAGG - Intergenic
1113271086 13:108675173-108675195 CTTCTGGATTTTAGACAAAAAGG + Intronic
1113288834 13:108883456-108883478 CTTTTGAACCTAAGAAAACATGG + Intronic
1113428129 13:110227157-110227179 ATTAAGTAGTTAAGAAAAAAAGG - Intronic
1114307393 14:21436796-21436818 ATTCTGCACTCATGAAAAAAGGG + Intronic
1114373742 14:22120170-22120192 CTTCAATAATTAAGAGAAAATGG - Intergenic
1114522049 14:23345989-23346011 CTAATGAACTTAAGCAAAAAGGG - Intergenic
1115744298 14:36420136-36420158 CTTCTGTTTATAAGAAAAAATGG - Intergenic
1115772827 14:36684271-36684293 CTTGTTTACTTGAGAAAAAGAGG + Intronic
1116056422 14:39869742-39869764 AATCTATAGTTAAGAAAAAATGG + Intergenic
1116522290 14:45864708-45864730 ATTCTGCCCTTAGGAAAAAAAGG + Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1118331255 14:64817695-64817717 CTCCTGTACATAAGGGAAAAGGG + Intronic
1118438188 14:65790165-65790187 TTTCTCCACTTAAAAAAAAAAGG - Intergenic
1118519671 14:66568888-66568910 CTTATGAACTTAAGAAATGATGG - Intronic
1118611389 14:67543151-67543173 CCTTTGTACTTATGAAAGAAGGG - Intronic
1118616496 14:67577661-67577683 CTCCTGTAGTTAAGCAGAAAAGG + Intronic
1120089311 14:80312645-80312667 CTTCTGTACTAAAAAATACAAGG - Intronic
1120135539 14:80864386-80864408 CTTCTATATTTCAGAAAAGAAGG + Intronic
1120834530 14:89027727-89027749 CTCCTGTCCGTAAGAAGAAAGGG + Intergenic
1121115936 14:91342761-91342783 TTTCTGTACTTAAGAATCACCGG - Intronic
1123063297 14:105604168-105604190 GTTCTCTACTTAGGATAAAATGG - Intergenic
1123087359 14:105722954-105722976 GTTCTCTACTTAGGATAAAATGG - Intergenic
1123577336 15:21684739-21684761 CTTATGTATGTAAGAAAAATTGG - Intergenic
1124879929 15:33632651-33632673 CTTCTGTTCTCTAGAAATAATGG - Intronic
1126853057 15:52810145-52810167 TTTTTGTACTTAAGAAAAAATGG - Intergenic
1127114756 15:55714543-55714565 TTTCTCTATTTAAAAAAAAAAGG - Intronic
1127415554 15:58753818-58753840 CATCTCTATTTAAAAAAAAAAGG + Intergenic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128933074 15:71723080-71723102 TTTCTCTATTTAAAAAAAAATGG + Intronic
1129309218 15:74694161-74694183 ATTCTGTAATTAATACAAAATGG - Intronic
1130240992 15:82191015-82191037 CTACTGTAATAAAAAAAAAAGGG + Intronic
1130315970 15:82796932-82796954 CTTTTGTAATAAAGAGAAAAAGG - Intronic
1131055756 15:89373460-89373482 CCTTGGTACTTAAAAAAAAAAGG + Intergenic
1132013864 15:98299306-98299328 ATTTTGTAATTGAGAAAAAAGGG - Intergenic
1132068297 15:98751571-98751593 CTTCTTTACTTATAAAAAACTGG - Intronic
1202986204 15_KI270727v1_random:418984-419006 CTTATGTATGTAAGAAAAATTGG - Intergenic
1133295174 16:4748402-4748424 CTTCTTTACCTAAGATAGAAAGG + Exonic
1133490387 16:6262427-6262449 AGTCTCTTCTTAAGAAAAAAAGG + Intronic
1134091335 16:11393161-11393183 CGTCTCTACTTAAAAAAAAGGGG - Intronic
1134171888 16:11975947-11975969 GTTCTCTACCAAAGAAAAAAAGG - Intronic
1134248366 16:12556795-12556817 CTTCTGTACTTTAGTAAAGGGGG - Intronic
1136408246 16:30061862-30061884 CTTCTTTACAAAAGAGAAAATGG - Intronic
1138138122 16:54541764-54541786 GTTCTGTAATTAAGACAAAATGG - Intergenic
1138582392 16:57950141-57950163 CTTCTGTACAAAAAGAAAAAAGG + Intronic
1138896885 16:61217169-61217191 CTTGTGTAAATAAGAAAAAGAGG - Intergenic
1140047393 16:71450846-71450868 GTTCCTTACTTAAAAAAAAATGG + Intronic
1140180706 16:72715066-72715088 CATCTCTACTTGAGAAAAAAGGG - Intergenic
1141530239 16:84641252-84641274 CTCCTTTATTTAAGAAAAATGGG - Intergenic
1141582084 16:85006570-85006592 TTTCTGTAATTTAAAAAAAAAGG + Intronic
1144379510 17:14680333-14680355 CTTCTTTACAAAAGAAGAAATGG + Intergenic
1146099837 17:29970453-29970475 CTTGTCTACTTGAAAAAAAATGG + Intronic
1146372575 17:32274697-32274719 CTTCTCTATTTAAAATAAAAAGG + Intronic
1149101683 17:52913867-52913889 CTTCTGTACTTAAAAATCAATGG - Intergenic
1149147881 17:53519419-53519441 CCTTTGTATTTAAAAAAAAAAGG - Intergenic
1150392739 17:64799595-64799617 TTTTTGTAATTAAAAAAAAAGGG + Intergenic
1155402935 18:25458507-25458529 ATTCAATACTTAAGAAAAAAAGG + Intergenic
1156013147 18:32516908-32516930 ATTCTGTACTTATGGAAAAGTGG + Intergenic
1156107740 18:33685999-33686021 CTTTTGTAATGAAGAAATAACGG + Intronic
1156220623 18:35047899-35047921 CTTATCTAGTTAAGAAAATATGG + Intronic
1156838528 18:41584288-41584310 TTTATGTATTTAAAAAAAAAGGG - Intergenic
1158149130 18:54347102-54347124 ATTCTCTAATTCAGAAAAAAAGG - Intronic
1158348240 18:56537650-56537672 ATGCTGGGCTTAAGAAAAAAGGG + Intergenic
1158636197 18:59160468-59160490 ATTGTTTTCTTAAGAAAAAATGG + Intergenic
1158803436 18:60941396-60941418 GTGCTGTAGTTTAGAAAAAAAGG - Intergenic
1159198802 18:65155782-65155804 ATTCTGTATTTTAGAAGAAAAGG + Intergenic
1159500673 18:69265163-69265185 TTTATGTACTAAAGAAAACATGG + Intergenic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1160115591 18:76076048-76076070 CCTCAGGACTTCAGAAAAAATGG + Intergenic
1161360525 19:3846739-3846761 CTTATGTAATTAAGGAAAACAGG - Intronic
1164681886 19:30140238-30140260 CTTCTGTAATAAAGAAAAAAGGG + Intergenic
1164931781 19:32181580-32181602 CAAATGTACTTAAGAAAGAAGGG - Intergenic
1165047900 19:33120688-33120710 CATCTCTATTTAAAAAAAAAGGG + Intronic
1165197331 19:34114881-34114903 CCTTTGTACTTAAAAAAAAAAGG - Intergenic
1167800671 19:51739333-51739355 CTGGTGTCCTTATGAAAAAAGGG - Intergenic
1167831828 19:52029302-52029324 CTTTTGTAATTTACAAAAAAAGG + Intronic
1168396439 19:56052745-56052767 CTTCTATTCTTAGGAAAAATGGG - Intronic
925563830 2:5227577-5227599 TTTCTCAAATTAAGAAAAAAAGG + Intergenic
926458923 2:13103205-13103227 CTTCCTTAGTTAAGAAAAGAAGG + Intergenic
930144766 2:47990806-47990828 CTTCTGTAACTCAGAAGAAAAGG + Intergenic
930257151 2:49105472-49105494 CTTTTGTGCTTAAAAAACAAAGG + Intronic
930758059 2:54998908-54998930 CTTCTATACTGCAGAATAAAGGG + Intronic
931070603 2:58644385-58644407 CTTCTGCACTTAAAAAAATGTGG - Intergenic
931242966 2:60468644-60468666 CTTCAGTACTTAAAAAGTAAGGG + Intronic
932066189 2:68564032-68564054 CATCTTTACTTTAGAAAAAATGG - Intronic
932147061 2:69330303-69330325 CTTTTGTATCTAAGAAATAAAGG - Intronic
932654526 2:73598266-73598288 CTTATGTACTAGAGAAAACAAGG + Intronic
932930734 2:76034793-76034815 CTTCAGTACACAAGGAAAAAGGG - Intergenic
933071115 2:77858996-77859018 CTTGTTGACTTAAGAGAAAAAGG + Intergenic
933126333 2:78611812-78611834 CTTGTGTAATTATGATAAAAAGG - Intergenic
933337744 2:80980724-80980746 CTACTGAACTTCAGAAAATAAGG - Intergenic
935871099 2:107450888-107450910 GTTCTGTATTTAAAAATAAAGGG + Intergenic
936699139 2:114988936-114988958 CATCTGCAATTAAAAAAAAAAGG + Intronic
936907829 2:117557398-117557420 CTTTTTTACTTAATTAAAAATGG - Intergenic
938216027 2:129516439-129516461 CTTCTGTACAGAAAAAGAAATGG - Intergenic
938801484 2:134767334-134767356 CATTTGTATTTAAGAAAAACTGG + Intergenic
938919075 2:135976035-135976057 CTTGAGTATTTAACAAAAAATGG + Intronic
939118096 2:138084565-138084587 CTTCCTTTGTTAAGAAAAAAAGG - Intergenic
939146815 2:138425479-138425501 CATCTGTACTTAACAAGAATGGG - Intergenic
939222376 2:139318958-139318980 CTTTTGAAATTAAGAAAAATCGG - Intergenic
939284275 2:140109011-140109033 CTTGTTTACATTAGAAAAAAAGG - Intergenic
939322584 2:140643156-140643178 TTTCTGTATTTAAGAAAAAAGGG - Intronic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939882534 2:147646571-147646593 CATTTGTACCTCAGAAAAAATGG + Intergenic
939987944 2:148850580-148850602 ATTCTGTGCTTAAGAAGGAAGGG - Intergenic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
941941954 2:171048963-171048985 CATCTGAACTCAAGAAAATATGG + Intronic
942362454 2:175186639-175186661 TCTCTGTAAGTAAGAAAAAAAGG - Intergenic
943757955 2:191577100-191577122 CTTCTGTATTTTAAAATAAATGG + Intergenic
943815053 2:192242991-192243013 GTTTAGTGCTTAAGAAAAAAAGG + Intergenic
943856257 2:192796258-192796280 ATTATGTAGTTAATAAAAAATGG + Intergenic
944075675 2:195728139-195728161 CTCCTGCAATTAAGAAACAATGG - Exonic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
944301071 2:198125534-198125556 CTCTTGTACTTGAAAAAAAATGG - Intronic
944518150 2:200533177-200533199 TTTCTGTACTTGATAAAATAAGG - Intronic
944553803 2:200868675-200868697 ATTCTGAAATTAAGAAAGAAAGG - Intergenic
945209234 2:207365084-207365106 CTTCAGTATTTAAAATAAAAAGG + Intergenic
945966549 2:216193575-216193597 CTTCTGCACTGGAGAACAAAAGG + Intronic
946263239 2:218514635-218514657 CTTTTGTAATTAAGAAATATAGG + Intronic
946937037 2:224733128-224733150 CCTCTGCATTAAAGAAAAAAAGG - Intergenic
947369368 2:229428762-229428784 GTGCTGTAGTTAAGAAAGAAAGG + Intronic
947837535 2:233186492-233186514 CTTCTTTGCTATAGAAAAAATGG + Intronic
947969307 2:234308906-234308928 CTTCTCTACTTTTCAAAAAAGGG - Intergenic
948036467 2:234862262-234862284 CCACTGTCCTTAAGAAAGAAAGG + Intergenic
948553418 2:238791327-238791349 CTCTTTTATTTAAGAAAAAAAGG + Intergenic
1169792120 20:9422240-9422262 CTTCTTTCCTTAACAAAATAGGG + Intronic
1170307319 20:14952974-14952996 CTTCTATTTTTAAGAAAAGAGGG + Intronic
1171003358 20:21437861-21437883 CTTATGTTCATAAGAAAATATGG + Intergenic
1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG + Intergenic
1171724131 20:28600230-28600252 CTACTGTGCTAAAGAATAAATGG + Intergenic
1171753928 20:29082803-29082825 CTACTGTGCTAAAGAATAAATGG - Intergenic
1171788315 20:29494724-29494746 CTACTGTGCTAAAGAATAAATGG + Intergenic
1171859235 20:30379791-30379813 CTACTGTGCTAAAGAATAAATGG - Intronic
1176067622 20:63206824-63206846 ATTCTGTACATAAGAAAACCTGG + Intronic
1177095954 21:16833245-16833267 TTTCTCTACTTAATAAAAAGAGG - Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178272202 21:31201217-31201239 CTTTTTTAAGTAAGAAAAAAGGG + Intronic
1178609750 21:34070741-34070763 CTTCTGTGCTTGTTAAAAAAAGG + Intergenic
1178677099 21:34640523-34640545 TTTCTTTTCTTAAGCAAAAAAGG + Intergenic
1178972973 21:37197272-37197294 CATCTCTTCTTAAAAAAAAATGG + Intronic
1180297683 22:10958905-10958927 CTACTGTGCTAAAGAATAAATGG + Intergenic
1180410743 22:12604880-12604902 CTACTGTGCTAAAGAATAAATGG - Intergenic
1183869173 22:40728297-40728319 CCTCTGTCCTTCTGAAAAAAAGG + Intergenic
951081482 3:18455162-18455184 CTTCTTCACTTAACAAAAATAGG - Intergenic
951267024 3:20579300-20579322 ATTCTGTTCTTCAGAAATAAAGG + Intergenic
951464059 3:22982921-22982943 CTGCTCCACTTAAAAAAAAATGG - Intergenic
952410373 3:33043908-33043930 CTTCAGTACTTAATAGTAAAGGG - Intronic
952706812 3:36386397-36386419 CTTCTACACTGAAAAAAAAAAGG + Intronic
952870312 3:37893820-37893842 ATTCAGTATTAAAGAAAAAATGG + Intronic
953077552 3:39583989-39584011 GTTCTGTACGTGAGAAAATAAGG + Intergenic
954567341 3:51609663-51609685 ATTCAGTAGTTGAGAAAAAAAGG - Intronic
955062853 3:55508206-55508228 CCTATGGACTTAAGTAAAAAGGG - Intergenic
955187619 3:56730333-56730355 CATCTGCATTTAAAAAAAAATGG + Intronic
956278620 3:67531174-67531196 TTTCAGCAATTAAGAAAAAATGG + Intronic
956657135 3:71563301-71563323 CTTCTGAGTTTAACAAAAAAGGG + Intronic
956863549 3:73347870-73347892 CTACTGTCCTCATGAAAAAAGGG - Intergenic
957023111 3:75146636-75146658 CTTTTGTACTCAAGAAAAGAAGG - Intergenic
957150164 3:76476257-76476279 AGTCTAGACTTAAGAAAAAAGGG - Intronic
957264948 3:77951101-77951123 CTTCTGCATTTGAGTAAAAAAGG + Intergenic
957356074 3:79088598-79088620 TTTCTTTACTTAACAACAAAAGG + Intronic
957500247 3:81047155-81047177 CCTCAATACTAAAGAAAAAATGG - Intergenic
957860039 3:85935231-85935253 CTTCTGTACTTCAGAGCAAGCGG + Intronic
957876429 3:86152892-86152914 TTTCTAAACTCAAGAAAAAAGGG + Intergenic
958507117 3:94993885-94993907 TTCTTGTACTTAAAAAAAAAAGG + Intergenic
958551904 3:95625428-95625450 CTTCTAAAGTTAGGAAAAAAAGG + Intergenic
958729148 3:97942198-97942220 CTTGTTTACCTAAGATAAAAGGG + Exonic
959660176 3:108859591-108859613 ATTCTGTACTTAGGAAAAATGGG - Intergenic
960102052 3:113754221-113754243 TTTCTGTAATTAGGAAAAACAGG + Intronic
960332139 3:116373754-116373776 TTTGTATATTTAAGAAAAAAGGG + Intronic
960562857 3:119104500-119104522 CTTTTGTAAATAATAAAAAATGG - Intronic
961267437 3:125655255-125655277 CTTCTATAATTAAAAAAAAAAGG + Intergenic
961942506 3:130652751-130652773 GTTCTGTTCTTAAAAAATAATGG - Intronic
962026189 3:131550196-131550218 TTTATGTTCTTAAGATAAAAAGG + Intronic
963207012 3:142646976-142646998 CTTATGTACCTTAGAAAAGAAGG - Intronic
963242674 3:143024067-143024089 CTTCTGAATTTAAAAAGAAATGG + Intronic
963289176 3:143469917-143469939 TGGCTGTACTCAAGAAAAAAAGG + Intronic
963380688 3:144526240-144526262 CTGCTGTACTTATGAAAGTAGGG - Intergenic
963488532 3:145968272-145968294 CTTCTGTAATCAAGGGAAAATGG - Intergenic
963962978 3:151330899-151330921 TTTCTCTACTTAAGAAATAAAGG - Intronic
964016436 3:151953041-151953063 CCTCTTTACCTCAGAAAAAATGG - Intergenic
964060437 3:152515538-152515560 TTTCTGTTGTTAAGAAATAAGGG + Intergenic
965286031 3:166821916-166821938 GTTTTGTACTTGAGAAGAAAAGG - Intergenic
965598964 3:170436409-170436431 CTTCTGTACTTTAGTATAGACGG - Intronic
965987151 3:174768263-174768285 CTTTTATACTTAAGTAAAATTGG + Intronic
966180642 3:177185436-177185458 TTTTTGTACTTAAGTAGAAATGG - Intronic
969488027 4:7483013-7483035 CTGATGTCCTTATGAAAAAAAGG + Intronic
971678113 4:29661164-29661186 CTCCTGTATGTAAGATAAAAAGG + Intergenic
971858097 4:32069128-32069150 CTTCTGAAATAAATAAAAAATGG - Intergenic
972156739 4:36172474-36172496 TTTCTGTAATTATTAAAAAATGG - Intronic
972474109 4:39434442-39434464 CTTCTCTGCTTCAGAGAAAATGG - Exonic
973585986 4:52391760-52391782 CCTATGTATTTAAGATAAAAAGG - Intergenic
974806405 4:66886098-66886120 CTTCTGTTCTTAATAGTAAAGGG - Intergenic
976050327 4:81004275-81004297 CTTCTCAACTGAAGTAAAAATGG + Intergenic
976694557 4:87905113-87905135 CTTCTGTTCATAGGAAAAGAAGG + Intergenic
977424363 4:96847848-96847870 CTTTTGAACATAAGAGAAAAAGG + Intergenic
977444292 4:97109829-97109851 GTTCTAGAGTTAAGAAAAAATGG - Intergenic
978676381 4:111323700-111323722 CTTCTCTACTCAAAACAAAAAGG - Intergenic
978906818 4:114015190-114015212 CTACTGTACTCAAGACAAGATGG - Intergenic
979032027 4:115661396-115661418 ATTCTGTTACTAAGAAAAAAAGG - Intergenic
979320072 4:119313161-119313183 CTTCTGGGTTTAAGAAAGAATGG + Intergenic
979325666 4:119376491-119376513 CTTCTGAGTTTAAGAAAAATAGG - Intergenic
980485023 4:133445580-133445602 ATTCTGGACTCAAGAAAAAATGG - Intergenic
980617991 4:135258381-135258403 ATTCTGTAAATAAGAAATAATGG - Intergenic
981473589 4:145165195-145165217 TTCCTGTATTGAAGAAAAAAAGG + Exonic
981569879 4:146140240-146140262 TTTCTGTAATAAGGAAAAAAAGG + Intergenic
981964780 4:150586847-150586869 CTTCTGAATTTAAGAAAGACTGG - Intronic
982060549 4:151600360-151600382 CTTCTCTGCTTCTGAAAAAATGG - Intronic
983225147 4:165079045-165079067 TTTCTATTCTTAAGAAATAAGGG - Exonic
983243575 4:165261637-165261659 CTTCTGAGTTTAAGAAAAATAGG - Intronic
983340739 4:166457317-166457339 TTGCTGTACTTAAGAAGGAAAGG + Intergenic
983607112 4:169600055-169600077 CTTCCTTACTTAAGAAGTAAGGG - Intronic
983822957 4:172219227-172219249 CTTCTGTTCTTAAAAAATATAGG + Intronic
984115049 4:175669823-175669845 CTGCTGTCCTTATAAAAAAAGGG + Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
985854062 5:2411507-2411529 CTTATCTACTTATGAATAAATGG - Intergenic
986248719 5:6035018-6035040 CTTGTCTACTTAATAAGAAAGGG - Intergenic
987197538 5:15541951-15541973 TTTGTGTAATTAAAAAAAAAAGG - Intronic
987440773 5:17953273-17953295 ATTCTGTAGTTATGAAAAAATGG - Intergenic
988114300 5:26864802-26864824 GTGCTGTACTTAAGACAAAAAGG - Intergenic
988716404 5:33833093-33833115 CATGTGTTCTTAGGAAAAAATGG - Intronic
989432849 5:41375509-41375531 CTTCCTTATTTAATAAAAAATGG + Intronic
989802069 5:45554812-45554834 CTTCTGTATTAAAGAAGAAGGGG + Intronic
990356451 5:54971672-54971694 CTTTTATAATTAGGAAAAAATGG - Intergenic
991003849 5:61808920-61808942 CTTCTGTAATTAAAAATCAAGGG - Intergenic
991564457 5:67990427-67990449 TTTCCGTACCTATGAAAAAAAGG - Intergenic
992150613 5:73898887-73898909 CTTATGTGCGTAAGATAAAATGG + Intronic
992303803 5:75413414-75413436 TTTGTGTACTAAAGAGAAAATGG + Intronic
993323854 5:86509858-86509880 CTCCTGTTCTTAATAGAAAAAGG - Intergenic
995248808 5:109965774-109965796 CTTCTGTACTCAGAGAAAAATGG + Intergenic
996178559 5:120390336-120390358 AGTCTGTCTTTAAGAAAAAATGG - Intergenic
996432287 5:123395247-123395269 TTTCAGTATTTAAGAAAAGAAGG + Intronic
997435880 5:133874905-133874927 CTTATAAAATTAAGAAAAAAGGG - Intergenic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
999255539 5:150208186-150208208 GTTCTGCACTTAAAAAAAAAAGG + Intronic
999459666 5:151747035-151747057 CTTTTGCAATTAAAAAAAAAAGG - Intronic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999813501 5:155151918-155151940 CTTCTGAACTAATCAAAAAATGG - Intergenic
1000522056 5:162307458-162307480 CATATGTAATTAAAAAAAAAAGG + Intergenic
1001055350 5:168445012-168445034 CTTCTTCACTTAAGAAGAAGAGG + Intronic
1001211051 5:169810675-169810697 CTTCTGTTTTTAAGAAAGACTGG + Intronic
1002906658 6:1454596-1454618 CTTCTAAATTTAAAAAAAAAAGG + Intergenic
1003050924 6:2780747-2780769 CTGCTGCACTTCAGAAACAATGG - Intronic
1003255170 6:4468917-4468939 TGTCTGTAATGAAGAAAAAATGG + Intergenic
1003792780 6:9565856-9565878 CTTCTGGAATTAAGAATAAATGG - Intergenic
1003833485 6:10041022-10041044 ACTCTGTTCTTAGGAAAAAAAGG + Intronic
1004550914 6:16646332-16646354 CTCCGCCACTTAAGAAAAAATGG + Intronic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1007033629 6:38652617-38652639 CTTCTGTAATTAAAAAAAATAGG - Intergenic
1007573656 6:42911092-42911114 CACCGGTACATAAGAAAAAATGG + Intergenic
1007603497 6:43099101-43099123 ATCCAGTACTTAAAAAAAAAAGG + Intronic
1008721489 6:54359018-54359040 GTTCTGTACCGAAGAAAAATGGG - Intronic
1008793984 6:55277393-55277415 CATCTGTAGTTCAGAGAAAATGG + Exonic
1008830754 6:55758176-55758198 CTTTTGTATTTAAGAAGAATGGG - Intronic
1009628298 6:66164312-66164334 CTTTTGGACTTAAGAGAAAGTGG + Intergenic
1009851384 6:69203856-69203878 CTTCTGTACATAAGAGCAGAAGG - Intronic
1010079799 6:71847498-71847520 ATTCTGTCCTTAATACAAAAAGG - Intergenic
1010261781 6:73825279-73825301 TTTCCCCACTTAAGAAAAAAAGG - Exonic
1010595531 6:77758425-77758447 CTCTTGTCCTTCAGAAAAAAAGG - Intronic
1012737576 6:102969994-102970016 CTTCAGTAGTTAAGATCAAATGG - Intergenic
1012767033 6:103380551-103380573 TTTGTGTGTTTAAGAAAAAATGG + Intergenic
1013156717 6:107498832-107498854 CTAGTGTTCATAAGAAAAAAAGG - Intronic
1014265037 6:119267960-119267982 CTTCTGTATTTATGACAAATTGG + Intronic
1014334171 6:120111118-120111140 GTACTGTACATAAGGAAAAAAGG - Intergenic
1014604730 6:123458852-123458874 TTTCTGTGATTAAAAAAAAAGGG + Intronic
1015525528 6:134172425-134172447 GTTGTGTAGTGAAGAAAAAAGGG + Intronic
1015893611 6:137994869-137994891 ATTCACTACTTAACAAAAAAGGG + Intergenic
1016079943 6:139843603-139843625 AGTCTTTATTTAAGAAAAAAAGG - Intergenic
1016132080 6:140486812-140486834 CTTCAGTACTTCAGAGAAACAGG - Intergenic
1016429920 6:143972834-143972856 CTTCTGTGTTTAAAAAAAGAGGG + Intronic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1016684718 6:146868130-146868152 GTTCTCTACCTAAGAAAAATTGG - Intergenic
1016871771 6:148825053-148825075 ATTCTGTACTTAAGAAAATGTGG - Intronic
1016918775 6:149270408-149270430 CTCTTGAACTAAAGAAAAAAAGG - Intronic
1017111654 6:150938470-150938492 TTTCTTTGCTTAAAAAAAAAAGG - Intronic
1017292000 6:152748273-152748295 ATTTTGCACTAAAGAAAAAAAGG + Intergenic
1017425504 6:154316428-154316450 ATTCTGTATTTAAAAAAAGAAGG + Intronic
1018292675 6:162308825-162308847 CTCATGTACATAAGTAAAAAAGG - Intronic
1019829216 7:3309934-3309956 CTGAACTACTTAAGAAAAAAAGG + Intronic
1020661042 7:10982906-10982928 CTACTGTAGTAAAGAGAAAAGGG + Exonic
1020847674 7:13307484-13307506 CTTCTGAAATAAAGGAAAAAAGG + Intergenic
1021993102 7:26155139-26155161 AATTTGTACTTAAGAAAAATAGG + Intronic
1022025836 7:26446928-26446950 CTTCTGAATTTAAAAAATAAAGG - Intergenic
1022328340 7:29353795-29353817 GTTCTGTAGTTTGGAAAAAAAGG + Intronic
1023263483 7:38381199-38381221 CTTCTTTATGTAAGAAAAGAGGG + Intergenic
1023332183 7:39130118-39130140 TTTCTTTACTTTAAAAAAAATGG - Intronic
1023581136 7:41684290-41684312 CTTATGTAGTAAAAAAAAAAGGG - Intergenic
1026310914 7:69183471-69183493 CTTCTACCCTTAAGAAATAATGG + Intergenic
1027529164 7:79308810-79308832 TTTCTTTTCTTAAGAAAATAAGG + Intronic
1027809321 7:82873735-82873757 CTTCTGGACTAAAGAAGAACTGG + Intronic
1027854860 7:83498454-83498476 CTTGTGTACTTAATAAAATCAGG + Intronic
1028129258 7:87151327-87151349 ATTATGTACTTATTAAAAAATGG + Intergenic
1028373693 7:90122047-90122069 CTGCTGGAATAAAGAAAAAAAGG - Intergenic
1030244159 7:107362565-107362587 CTTTTATGCTTAAGAAAGAAAGG + Intronic
1030332934 7:108292341-108292363 TTTCTTTACTTGTGAAAAAACGG + Intronic
1030994359 7:116340285-116340307 CTTCTGCACATAGGAAGAAAGGG + Intronic
1031225697 7:119035220-119035242 CTTTTTTCCTTAAAAAAAAAAGG - Intergenic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1034731609 7:153392035-153392057 CTTGTGTACTTAAGGAACATGGG + Intergenic
1034732934 7:153403635-153403657 TTTCGGTGCTTGAGAAAAAAAGG + Intergenic
1035774313 8:2175770-2175792 CTACTGTACTTAAAGTAAAAAGG - Intergenic
1035887473 8:3307575-3307597 TTTCTGAACTAAAGAAGAAAAGG - Intronic
1035963250 8:4160340-4160362 CTTCATTACTTTACAAAAAATGG - Intronic
1036481784 8:9146540-9146562 GTTCTGTACTTTTGGAAAAATGG - Intronic
1036634908 8:10542497-10542519 GTTTTGTATTTAAGAATAAAGGG + Intronic
1037283078 8:17265397-17265419 CTTCTCTACTTAGAAAAAAGGGG + Intronic
1038165524 8:25081773-25081795 CTTCTGTCCTTATAAAAAGAGGG - Intergenic
1038360950 8:26876578-26876600 AATCTGTACTTCAGAAATAAGGG - Intergenic
1038603587 8:28974619-28974641 GTTCTGTAGATAAGACAAAATGG + Intronic
1041861308 8:62516041-62516063 CTTCCTTTCTTAAAAAAAAATGG - Intronic
1042287272 8:67127426-67127448 TAAATGTACTTAAGAAAAAATGG - Intronic
1042517697 8:69676983-69677005 ATTCTATAATTAAAAAAAAATGG - Intronic
1043501405 8:80861215-80861237 CTTCTGCAGTTCAGAAATAAGGG - Intronic
1043679603 8:83006278-83006300 CTTATGAACTAAAGGAAAAAAGG + Intergenic
1044617027 8:94152834-94152856 CTTCTCTACTAAAAATAAAAGGG - Intronic
1045008090 8:97933449-97933471 CTTCTGTATTTATCAGAAAATGG + Intronic
1045906467 8:107351775-107351797 CTTATGTTACTAAGAAAAAAAGG - Intronic
1046785150 8:118257867-118257889 GCTCTGTACATAATAAAAAAGGG - Intronic
1046799964 8:118415196-118415218 CTCCTGTCCTTCAGAAGAAAAGG + Intronic
1047902006 8:129432643-129432665 CTTTGGTAGTTGAGAAAAAATGG - Intergenic
1049132100 8:140855285-140855307 TTTCTAGACTTAAAAAAAAAGGG + Intronic
1051194692 9:14551017-14551039 CTTTTATACTTAGGGAAAAAAGG + Intergenic
1051573967 9:18593922-18593944 AATCTGTACTAAAGACAAAATGG - Intronic
1051921000 9:22264564-22264586 CATGTGCACTTAAGAAGAAAGGG + Intergenic
1052047122 9:23806970-23806992 CTTCTGCACCTAAGGAAAAGGGG + Intronic
1052201073 9:25781020-25781042 CTTCTGTACTGAAGGAAAAGGGG - Intergenic
1052371566 9:27671222-27671244 TTTCTGTACTGAAAAAAAACAGG + Intergenic
1052870709 9:33503649-33503671 CTTCCATATTTATGAAAAAATGG + Intergenic
1053343178 9:37356829-37356851 TTTCAGTACTCAAGAAAAATGGG + Exonic
1053725473 9:40994839-40994861 CTACTGTGCTAAAGAATAAATGG - Intergenic
1054340469 9:63857038-63857060 CTACTGTGCTAAAGAATAAATGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055644303 9:78348303-78348325 CTTCTGTTTTTAGGAAGAAATGG + Intergenic
1055717541 9:79134498-79134520 TTTGTGTATTTAAGAGAAAAGGG + Intergenic
1056234524 9:84580116-84580138 TATTTGCACTTAAGAAAAAAAGG + Intergenic
1056501770 9:87216602-87216624 CTGCTGAACTGTAGAAAAAATGG + Intergenic
1056809321 9:89752137-89752159 CTTCTTCAATTAAAAAAAAAAGG - Intergenic
1056862580 9:90200328-90200350 CTTCTGTCCCTTAGATAAAATGG + Intergenic
1057687812 9:97251713-97251735 CTTCCATATTTATGAAAAAATGG - Intergenic
1057904427 9:98973380-98973402 CTTCTGTAATTCAGAAAAATAGG + Intronic
1057994083 9:99804024-99804046 CTTGTGTAATTGAGATAAAAGGG - Intergenic
1058300135 9:103361278-103361300 CTTTTGTACACAAGATAAAATGG - Intergenic
1058367549 9:104227863-104227885 TTTCTCTGCTTAAGCAAAAATGG + Intergenic
1059550040 9:115220085-115220107 TGTGTGTATTTAAGAAAAAAGGG + Intronic
1060348032 9:122833799-122833821 CATCTCTACTAAAAAAAAAAAGG - Intergenic
1062719134 9:138025880-138025902 TCTCTGTACTTAAGAAAGGAGGG - Intronic
1203449339 Un_GL000219v1:97132-97154 CTACTGTGCTAAAGAATAAATGG + Intergenic
1186995201 X:15114206-15114228 TCTCTGTACTTCAGAAAAATGGG - Intergenic
1187480010 X:19646846-19646868 CTTCTGTATTGGATAAAAAATGG + Intronic
1187813909 X:23210204-23210226 ATTCTGAACTTAGGAAAACATGG - Intergenic
1189135501 X:38545220-38545242 CTTCTTTACTCAAAAAATAAGGG + Intronic
1189173111 X:38928374-38928396 CTTTTGTCCATAAAAAAAAATGG - Intergenic
1189704421 X:43745531-43745553 TTTCAGTACTTAAGAGAAATTGG - Exonic
1190429714 X:50367508-50367530 CCTCTGTACTCAAGGGAAAAGGG + Exonic
1190847425 X:54207322-54207344 CTTCTGTACTTAAAAAAATTTGG - Intronic
1192585057 X:72312829-72312851 CTTCTGTGTTTAAAAAAAAAGGG + Intergenic
1193686654 X:84584805-84584827 CTTCCGTTAGTAAGAAAAAAAGG + Intergenic
1195523368 X:105856656-105856678 CTGCTGTACCTAAGAAAATCAGG - Intronic
1195607574 X:106826010-106826032 CCTCTGTAGGAAAGAAAAAATGG - Exonic
1195980788 X:110576430-110576452 AATTTATACTTAAGAAAAAAAGG + Intergenic
1196226577 X:113175116-113175138 TTGCTATACTTAAGTAAAAATGG - Intergenic
1196406376 X:115366641-115366663 CTTTTGCACTTAAGAACGAATGG - Intergenic
1196961512 X:121008027-121008049 CTTGTTTACTTGAGAAAGAATGG + Intergenic
1197721378 X:129747088-129747110 CTTCTGAGTTTAAAAAAAAAAGG + Intronic
1198653488 X:138889189-138889211 CTTCTGTAGTTCAGCAAAGAAGG - Intronic
1198770831 X:140128194-140128216 TTTCTGTACTTAAAGAAAAATGG + Intergenic
1201495117 Y:14584421-14584443 CATAAGTACTTAAGAATAAATGG - Intronic
1201918020 Y:19203597-19203619 CTTCTATGTTTAAGAAAAGAAGG - Intergenic
1202331993 Y:23763889-23763911 CTCATGTACTTAGTAAAAAAAGG + Intergenic
1202538776 Y:25906171-25906193 CTCATGTACTTAGTAAAAAAAGG - Intergenic