ID: 1117835221

View in Genome Browser
Species Human (GRCh38)
Location 14:59797782-59797804
Sequence GTGTTAACAAAGATGACGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117835221_1117835223 10 Left 1117835221 14:59797782-59797804 CCTAGCGTCATCTTTGTTAACAC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1117835223 14:59797815-59797837 TAGTGTTTATAGTGTTTGAAAGG 0: 1
1: 1
2: 0
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117835221 Original CRISPR GTGTTAACAAAGATGACGCT AGG (reversed) Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
901819710 1:11820283-11820305 GTCTTAAAAAAAATGATGCTGGG + Intronic
908778725 1:67668429-67668451 GAGTGAACCAAGATGACGTTTGG + Intergenic
910626644 1:89314400-89314422 GTGTTTGCTAAGATGAGGCTTGG + Intergenic
910798765 1:91124293-91124315 GTGTTTGCAAATGTGACGCTAGG + Intergenic
912324552 1:108745522-108745544 GTGGGAACAAAGATCAGGCTTGG - Intergenic
912947102 1:114094456-114094478 GTGGTAACAATGATGACACATGG + Intronic
916657702 1:166891976-166891998 GAGTTCATAAAGATGAAGCTAGG - Intergenic
917094566 1:171387120-171387142 GTCTTAAAAAAAATGATGCTTGG + Intergenic
917696524 1:177530901-177530923 GTGTTAACAATCATGTCTCTGGG - Intergenic
918417315 1:184324619-184324641 ATGTTGTCAAAGATGGCGCTTGG - Intergenic
918651868 1:186975030-186975052 GTGTTTACAAACATGACTCAAGG - Intronic
918748025 1:188231348-188231370 GTCTTAACAAAAATGATACTGGG - Intergenic
923605807 1:235441418-235441440 CTGTTACCAAAGGTGACACTCGG + Intronic
923635233 1:235689341-235689363 GTGATAACACAAATGACCCTGGG + Intronic
1067838261 10:49654921-49654943 GAATTCCCAAAGATGACGCTGGG - Intronic
1068416079 10:56724592-56724614 GTATTAAGAAAGATGAGGCCGGG + Intergenic
1069901023 10:71706754-71706776 GTGTTGACACAGATGCCACTTGG + Intronic
1075602568 10:123781205-123781227 GTGTTAACAGAGCTGACCTTTGG + Intronic
1086079042 11:82883704-82883726 GTGTAAGCAAAGATGAGACTTGG + Intronic
1089001132 11:115053410-115053432 GTATTAACAAACATGGGGCTGGG - Intergenic
1100743833 12:97623823-97623845 GTGGTGACAGAGAAGACGCTAGG - Intergenic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1104823286 12:131691090-131691112 GTTTTACAAAAGAGGACGCTGGG + Intergenic
1108854940 13:54781330-54781352 GTGTTTACGAAGATGAACCTTGG - Intergenic
1109804247 13:67416995-67417017 AAGTTAACAAAGATGACTATTGG + Intergenic
1110328709 13:74246862-74246884 GTGTTAAAAAAGATGAGGGAGGG + Intergenic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG + Intergenic
1116629750 14:47314985-47315007 ATGTTAACAATGATGATGCTTGG + Intronic
1117835221 14:59797782-59797804 GTGTTAACAAAGATGACGCTAGG - Intronic
1126734939 15:51721427-51721449 ATGTTATCAAAGATGACTCATGG - Intergenic
1128192914 15:65720732-65720754 CAGTTAACAAGGATGAAGCTGGG - Intronic
1129871181 15:78942733-78942755 GTTTTAGCAAAGAGGACACTTGG + Intronic
1133508084 16:6431588-6431610 GTGAGTACAAAGATGATGCTGGG + Intronic
1143253748 17:5540871-5540893 GTGTGAACAAAGATCTCGCAAGG + Intronic
1144645197 17:16968470-16968492 GTGTTTTCAAAAATGATGCTGGG + Intronic
1145988441 17:29063059-29063081 GCTTTAAAAAAGATGATGCTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1151918994 17:77140317-77140339 GTGTTGACAAGGATGCCGCTGGG + Intronic
1153852457 18:9108633-9108655 ATTTTAACAAAGTTGATGCTGGG - Intronic
1155876025 18:31089393-31089415 GTATTAGCAATGATGATGCTTGG - Intronic
1158166294 18:54544962-54544984 ATGTTATGAGAGATGACGCTGGG - Intergenic
1159471782 18:68867041-68867063 GTGTGTGGAAAGATGACGCTGGG - Intronic
1159843272 18:73426209-73426231 GTGCTAGCAAGGAGGACGCTGGG + Intergenic
1163138153 19:15328524-15328546 GTTTCAACTAAGATAACGCTGGG - Intronic
1163291725 19:16383630-16383652 GTGTTTACACAGATGAGCCTGGG - Intronic
1164469796 19:28520413-28520435 GTGTTAATCATGATGACGCCAGG - Intergenic
1164813932 19:31179709-31179731 GTGGTAACAATGATGATGGTAGG + Intergenic
1168461586 19:56563719-56563741 CTGTTAACAAAGAGGACATTAGG - Intergenic
927032252 2:19133392-19133414 GTGTGAACAAAGACTACTCTGGG + Intergenic
928763965 2:34619183-34619205 TGGTTAACAAAGATGATACTTGG + Intergenic
932666656 2:73703847-73703869 GTGTTCACAAAGAAGCCGCCTGG + Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
935965445 2:108468456-108468478 GTGTTAAAAGAGCTGACTCTTGG + Intronic
937655402 2:124369131-124369153 GTGTTACCAGAGATGATTCTTGG + Intronic
937742695 2:125375063-125375085 GTGTTAGAAAAGGAGACGCTTGG + Intergenic
939643308 2:144666488-144666510 GTTTTAACAAATCTGACCCTTGG - Intergenic
941842463 2:170101143-170101165 TTGTTCAAAAACATGACGCTGGG + Intergenic
941842519 2:170101922-170101944 TTGTTCAAAAACATGACGCTGGG - Intergenic
943424874 2:187718994-187719016 GTGTTCCCAAAGGTGAAGCTGGG + Intergenic
947729029 2:232418060-232418082 ATGTACAGAAAGATGACGCTGGG - Intergenic
1169699608 20:8431733-8431755 GTGTCAGCAAAAATTACGCTGGG + Intronic
1171114141 20:22509706-22509728 ATGTGGACAAAGATGACTCTTGG + Intergenic
1173052889 20:39581890-39581912 GTGATGAGAAAGAAGACGCTAGG + Intergenic
1173710976 20:45155527-45155549 GTATTAACAAAGATATGGCTTGG + Intergenic
1174074071 20:47919691-47919713 GTGTTCACAAGGATGATACTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1177438223 21:21083708-21083730 ATTTTAAAAAAGATGAGGCTGGG - Intronic
1182063555 22:27415081-27415103 GCATTAAAAAAGAGGACGCTGGG - Intergenic
1185007439 22:48289658-48289680 GTGATAACAAAAATGCCCCTGGG - Intergenic
952937602 3:38412478-38412500 GTGGTATCAAAGAAGACCCTTGG + Intronic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
964438643 3:156679748-156679770 CTGTGAACAAAGATGACTCAAGG - Intronic
964820571 3:160764290-160764312 GTTTTAAAAAAGGTGAAGCTGGG - Intronic
964937851 3:162115065-162115087 GTGTTTACAAAATTGACTCTTGG - Intergenic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
972843496 4:42959268-42959290 GTGATAACATAGATGAACCTAGG + Intronic
972974332 4:44615130-44615152 GTGTTGACAAAAATAATGCTAGG + Intergenic
975182094 4:71358017-71358039 GTGTTAAGAGAGATGAGGCCGGG + Intronic
978088202 4:104681416-104681438 GTATTAATAAAAATGATGCTTGG + Intergenic
985124788 4:186682699-186682721 CTGTTAGCAAAGAGGACACTGGG + Intronic
986825040 5:11511397-11511419 GTGGTAACAAAGAGGAAGCCAGG + Intronic
987757220 5:22111670-22111692 GTATTAACAAAAATGACTTTTGG - Intronic
992186448 5:74249173-74249195 GTTTTAAAAAATATGAGGCTAGG + Intergenic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
1000501212 5:162053287-162053309 GAGTTATCAAAGATGACTCCAGG + Intergenic
1002556239 5:180043526-180043548 GAGGTAAAAAAGATGAGGCTTGG - Intronic
1003079242 6:3007714-3007736 CTGATAACAAAGAGGACTCTAGG - Intronic
1003678069 6:8225376-8225398 GTGTTTACAAAGTTGACAGTAGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005293949 6:24405701-24405723 ATGTTAACAAAGGTGACTCTAGG + Intronic
1008626266 6:53319853-53319875 GTGTTTACAAAGATGACAAAGGG - Intronic
1011793784 6:90930071-90930093 GTGTAAACTAACATGAAGCTAGG + Intergenic
1012150594 6:95746048-95746070 GTTTTAAAAAAGATGACCTTCGG + Intergenic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1020008989 7:4798426-4798448 TTGCTATCAAAGATGACCCTGGG + Intronic
1020224057 7:6265791-6265813 GTGTGAACAAGGATGACAATGGG + Intronic
1022665682 7:32408092-32408114 GGGTTAAGAAAGATGATACTGGG + Intergenic
1031767117 7:125794630-125794652 GTGTTAACACAGAAGAGGCCAGG + Intergenic
1039259415 8:35754445-35754467 CTGTTAACCAAAAGGACGCTGGG + Intronic
1040110516 8:43565103-43565125 GTGAGAACAAAGAGGAGGCTGGG - Intergenic
1041126799 8:54649586-54649608 GAGGTAACAAAGATGAAGCAGGG + Intergenic
1045014869 8:97992247-97992269 ATGTTAACAAAGGTGAATCTGGG + Intronic
1047399962 8:124538157-124538179 GAGTGAACAAAGATGACTCAGGG - Intronic
1048277624 8:133078928-133078950 GTGTAAAGAAAGATGTCGGTAGG + Intronic
1048460133 8:134614668-134614690 GTGTTCAAAAAGATGAAGCTAGG + Intronic
1049272303 8:141702451-141702473 GTATTTAGAAAGATGACGCAGGG - Intergenic
1049803939 8:144530495-144530517 GTGTTCTCGAAGATGACGCGCGG + Exonic
1054960559 9:70963635-70963657 ATGTTTACAAAAATGAGGCTTGG + Intronic
1055002220 9:71464639-71464661 ATGTTAACAATGAGGAAGCTTGG + Intergenic
1055665550 9:78549433-78549455 GAGTTAACAAAGATAACAATAGG + Intergenic
1057094851 9:92296569-92296591 GTGTTAACCATTATGACCCTAGG - Intergenic
1057161064 9:92888680-92888702 GTGTTAACAGAGAACACGGTGGG + Intergenic
1060215084 9:121734075-121734097 GTGTTACTAAAGATGTTGCTGGG + Intronic
1187069113 X:15870396-15870418 GTGTTGAAAAAGACCACGCTAGG - Intergenic
1188967342 X:36570759-36570781 GTATTAACACAGATGTCTCTAGG + Intergenic
1193806507 X:86002229-86002251 GTGCTAACAAAGAAAACCCTAGG + Intronic