ID: 1117835668

View in Genome Browser
Species Human (GRCh38)
Location 14:59803358-59803380
Sequence GATACTAGTTCCCCTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117835668 Original CRISPR GATACTAGTTCCCCTCCTGA AGG (reversed) Intronic
900094125 1:933508-933530 GAAACTAGTTCTCCTCCTGCAGG + Intronic
900632557 1:3644405-3644427 GCCACTAGGTCCCCTTCTGAAGG - Intronic
904993592 1:34613739-34613761 CTTGCTAGGTCCCCTCCTGAGGG - Intergenic
906458931 1:46022598-46022620 GTTACTAGTTCCCATCCTGCTGG - Intronic
907016535 1:51020739-51020761 GATACTAGTTAACTTTCTGAAGG - Intergenic
910143399 1:84051932-84051954 GGCACTAGATCTCCTCCTGAAGG + Intergenic
910445242 1:87293371-87293393 GATGTTTGTTCCCCTGCTGAAGG + Intergenic
910898128 1:92090336-92090358 GATACTAGTTCACATCCACAAGG - Intronic
911228541 1:95334490-95334512 GTTACTAGTTCCATTCCTGAGGG + Intergenic
911710003 1:101060822-101060844 GACACTAGTTCCATTCATGAGGG + Intergenic
924433333 1:244016460-244016482 GACACTAATTCCCTTCATGAGGG - Intergenic
1076473760 10:130738298-130738320 GATGCTGTTTCCACTCCTGACGG - Intergenic
1079991622 11:27252613-27252635 GGTACTAGTTCCATTCATGAGGG - Intergenic
1085895892 11:80639046-80639068 GGGACTAGTTCACCTCCTGCTGG + Intergenic
1087825909 11:102764554-102764576 GTCACTTGTTCCCTTCCTGAAGG + Intergenic
1088031345 11:105254570-105254592 TATACTAGGTGCACTCCTGAAGG - Intergenic
1091339023 11:134795860-134795882 GATAATACTCCCCCTCCAGAAGG - Intergenic
1094015544 12:25858932-25858954 CAGACTAGTTCCTCCCCTGAGGG - Intergenic
1097404995 12:59178103-59178125 GATACTTGAACACCTCCTGATGG + Intergenic
1100222541 12:92521503-92521525 GATACTAATCCCACTCATGAGGG - Intergenic
1109379809 13:61544397-61544419 GATACTAATCCCACTCATGAAGG + Intergenic
1110035205 13:70673544-70673566 GATGCTAGTTCTCCAGCTGAGGG - Intergenic
1114061523 14:19021732-19021754 AATCCTTGTTCCTCTCCTGATGG + Intergenic
1114100725 14:19378214-19378236 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1117835668 14:59803358-59803380 GATACTAGTTCCCCTCCTGAAGG - Intronic
1119767737 14:77200860-77200882 GACAATAGTTCCCCTCTTGGTGG + Intronic
1123495697 15:20823236-20823258 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1123552184 15:21392328-21392350 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1123588428 15:21829725-21829747 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1126435547 15:48633781-48633803 GATACCAGTCCACCTCTTGAGGG + Intronic
1127514305 15:59676815-59676837 GCTACTACTTCCCTTCCTGCCGG + Intronic
1127771616 15:62235889-62235911 TATACTCCTTCCCCTGCTGATGG + Intergenic
1130904359 15:88229321-88229343 GATCCTAGTTCTCCTGCTCATGG - Intronic
1131682052 15:94734004-94734026 GAAACCAGTTCCCCTCTTGAAGG - Intergenic
1202960532 15_KI270727v1_random:119559-119581 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1138183601 16:54959886-54959908 GACATTAATTCCCCTCCTGATGG + Intergenic
1141311308 16:82915854-82915876 TATAGCAGTTCCCCTTCTGATGG - Intronic
1142998766 17:3777419-3777441 GAAAGGAGTTCCTCTCCTGACGG + Intronic
1144123591 17:12180295-12180317 GATACTTCTTCCAGTCCTGATGG + Intergenic
1145829665 17:27905779-27905801 GATTCTAGTTCCCTTGCTGTGGG - Intergenic
1147033497 17:37661351-37661373 GATACTAGTTCCCATTTTGGGGG + Intergenic
1150266300 17:63834411-63834433 GGAACCAGCTCCCCTCCTGAGGG + Intronic
1154453101 18:14495668-14495690 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1156233577 18:35179534-35179556 ACTACTTGTTCCCTTCCTGAGGG - Intergenic
1156278912 18:35613513-35613535 GATACTGGCTCCCGTGCTGAGGG + Intronic
1163263027 19:16202715-16202737 GTTTCTAGTTCACCTGCTGAAGG + Intronic
1163729780 19:18942080-18942102 GATCCTAGTTCAACTCCGGAAGG - Intergenic
928672873 2:33620482-33620504 GATATTAAGTCCCATCCTGATGG - Intergenic
930798036 2:55413393-55413415 GATAATGTTTCCCTTCCTGATGG - Intronic
931047354 2:58370643-58370665 GATAGATGTTCCTCTCCTGAAGG - Intergenic
934579250 2:95425486-95425508 GATTCCAGTTCCCTTCCTGATGG + Intergenic
934600196 2:95651238-95651260 GATTCCAGTTCCCTTCCTGATGG - Intergenic
936533544 2:113293237-113293259 GATTCCAGTTCCCTTCCTGATGG - Intergenic
937878646 2:126848500-126848522 GGTACTAATTCCATTCCTGAGGG + Intergenic
939747349 2:145992397-145992419 GAGATTGCTTCCCCTCCTGATGG + Intergenic
939814239 2:146874260-146874282 CATTCTAGTTTCCTTCCTGAAGG + Intergenic
940182229 2:150947403-150947425 GATACTAATTCCATTCATGAGGG + Intergenic
940854154 2:158716838-158716860 GATGCTATTTTCCCTCCTGCAGG - Intergenic
946539712 2:220670835-220670857 GACCTTAGTTCCCCTCCTGGAGG - Intergenic
947457405 2:230267865-230267887 GACACTAGGTGCCCTCATGAAGG + Intronic
1174881008 20:54279699-54279721 GATACTAATTCCATTCCTAAGGG + Intergenic
1176235186 20:64050537-64050559 GAGCCCAGATCCCCTCCTGATGG - Intronic
1176442930 21:6792581-6792603 AATCCTTGTTCCTCTCCTGATGG + Intergenic
1176821087 21:13657595-13657617 AATCCTTGTTCCTCTCCTGATGG + Intergenic
1180480011 22:15744332-15744354 AATCCTTGTTCCTCTCCTGATGG + Intergenic
1181848207 22:25730172-25730194 GATGCTATTTCCCCTCCTTCTGG - Intergenic
1182699152 22:32219248-32219270 GCTACTAATTCCCCTCCATAGGG - Intronic
952310611 3:32185973-32185995 AATCATAGGTCCCCTCCTGATGG + Intergenic
956571870 3:70705624-70705646 GATACTAGTGCCATTCTTGAGGG + Intergenic
969312150 4:6359977-6359999 AATACTGGTTCACCTCATGATGG + Intronic
972559927 4:40217988-40218010 TATACCAGTTGCTCTCCTGATGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976563749 4:86530687-86530709 GATACTAATCCCATTCCTGAAGG + Intronic
977546267 4:98383324-98383346 GATACTTTTTCCTTTCCTGATGG - Intronic
979211896 4:118114784-118114806 GATAATATTTCCCCCCCTAAAGG + Exonic
980287896 4:130805321-130805343 GACACTATTTTTCCTCCTGAAGG + Intergenic
982117982 4:152113599-152113621 GATACTATTTCCTCTCCTTCAGG + Intergenic
991270655 5:64775515-64775537 CATACTAGTTCCCCTTCTTTTGG + Intronic
994603106 5:101933088-101933110 GAGTTAAGTTCCCCTCCTGAGGG - Intergenic
995396911 5:111696833-111696855 GAGATTAGGGCCCCTCCTGATGG + Intronic
998101593 5:139439384-139439406 GGTACTAGGTCCCCGCCTGAAGG - Exonic
1004969800 6:20897173-20897195 GACACTAGTCCCATTCCTGAGGG + Intronic
1010168780 6:72950047-72950069 TATACTAATTCTGCTCCTGAAGG - Intronic
1015819563 6:137245900-137245922 GATTCTAGTTCCTCACCAGATGG - Intergenic
1029031824 7:97476453-97476475 GGTAATAGTTCCCCTCTTGAAGG - Intergenic
1032239130 7:130147804-130147826 GACACTGGTGCCCTTCCTGAAGG - Intergenic
1036918214 8:12825691-12825713 GAACCTAGTGCCTCTCCTGAAGG - Intergenic
1039192179 8:34988685-34988707 GATCCTAGTTCCATTCATGAGGG + Intergenic
1046913476 8:119655018-119655040 CTTACTATTTCACCTCCTGAAGG + Intronic
1050522029 9:6510998-6511020 GAGACTAGTAACCCTCCAGATGG + Intergenic
1052781757 9:32788789-32788811 CATACTAGTTCTGGTCCTGATGG - Intergenic
1203526273 Un_GL000213v1:91950-91972 AATCCTTGTTCCTCTCCTGATGG - Intergenic
1185838485 X:3367466-3367488 CATACTTGGTCCCCTCCTGCTGG - Intergenic
1191965195 X:66750534-66750556 GATACCAGTGCCCCTTCTGATGG + Intergenic
1195649740 X:107272523-107272545 CAGACTAGTTCCCCTCCAGCTGG - Intergenic
1196074081 X:111555765-111555787 GCAACTAGTCCCCATCCTGAGGG - Intergenic