ID: 1117839707

View in Genome Browser
Species Human (GRCh38)
Location 14:59846939-59846961
Sequence CAGACACTAGGTTTCTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117839707_1117839711 17 Left 1117839707 14:59846939-59846961 CCATTCTAGAAACCTAGTGTCTG 0: 1
1: 0
2: 0
3: 5
4: 152
Right 1117839711 14:59846979-59847001 CCTAATTGAAAAAGTCAAAAAGG 0: 1
1: 0
2: 1
3: 39
4: 444
1117839707_1117839712 18 Left 1117839707 14:59846939-59846961 CCATTCTAGAAACCTAGTGTCTG 0: 1
1: 0
2: 0
3: 5
4: 152
Right 1117839712 14:59846980-59847002 CTAATTGAAAAAGTCAAAAAGGG 0: 1
1: 0
2: 6
3: 51
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117839707 Original CRISPR CAGACACTAGGTTTCTAGAA TGG (reversed) Intronic
902858014 1:19223315-19223337 CAGCAACTGGGTTTCTGGAAAGG + Intronic
904037213 1:27565275-27565297 CAGACCCCAGGATCCTAGAACGG + Intronic
908003877 1:59708646-59708668 GAGGAACTAGATTTCTAGAAAGG + Intronic
908517105 1:64904087-64904109 TAGACACTATGGTTCTAGTAAGG + Intronic
909329882 1:74398208-74398230 CAGACCCTAATTTTCTAAAAAGG + Intronic
914001915 1:143701728-143701750 CAGACAGTAGGCTGATAGAAAGG + Intergenic
916427477 1:164694662-164694684 CAAATATTAGGTTTCTAGATTGG - Intronic
916970838 1:170013320-170013342 AAAACACTAGATATCTAGAAAGG - Intronic
917198979 1:172495870-172495892 GAGGAACTAGGTATCTAGAAAGG + Intergenic
919359530 1:196573927-196573949 CAGATACTTAGTTTCTTGAAGGG + Intronic
919369448 1:196705461-196705483 CAGACACTTGACTTCTAGAATGG + Intronic
924041085 1:239984523-239984545 CAGCCACTATGTTTCTTCAACGG + Intergenic
1063725778 10:8635957-8635979 CAGAATTTAGGTTTCTAAAATGG - Intergenic
1064265527 10:13822412-13822434 CAGACAGTAAGTTCCTGGAAGGG + Intronic
1064655882 10:17555595-17555617 GAGACACTAGGATTCCAGGATGG - Intergenic
1065123007 10:22546078-22546100 CAGACTCTTTGTTTCTTGAATGG - Intronic
1065203333 10:23334837-23334859 CAGTCACTAGGTGACTACAAGGG + Intronic
1068639491 10:59387322-59387344 CAGACACTAGATTTCAAGTCAGG - Intergenic
1069466766 10:68646944-68646966 TAGACACTAGGTTTTTTGTAGGG - Exonic
1070772828 10:79092269-79092291 CAGCCACCAGTTTTCCAGAAGGG - Intronic
1070917062 10:80161711-80161733 AAGACACCAGGTTTCTACACCGG + Intronic
1071008913 10:80914853-80914875 CAGAGACTAGTTTTCTTAAAAGG - Intergenic
1072012363 10:91313856-91313878 CAAAGACTTGGTTACTAGAAAGG + Intergenic
1074534490 10:114319194-114319216 CAGATACTTGGCTTCTAGGAGGG + Intronic
1078661258 11:13288235-13288257 AAGTCACTAGGTGTCTAAAATGG - Intronic
1079351886 11:19698640-19698662 CAGACACAACCTTTCTGGAAGGG + Intronic
1081111452 11:39138797-39138819 CTCACACTAGATTTCTAGATTGG - Intergenic
1081340491 11:41921525-41921547 TAGACACTGGGTCTCCAGAAAGG - Intergenic
1084652292 11:70496283-70496305 CAGACACATGGCTTCTGGAAGGG - Intronic
1087437524 11:98140759-98140781 TAGACACTAGGATTCCAAAAGGG + Intergenic
1088834978 11:113569902-113569924 CAGACCCAAAGCTTCTAGAAGGG + Intergenic
1096890017 12:54760312-54760334 CAGACTCATGGTTTCTAGATCGG - Intergenic
1097423755 12:59415406-59415428 CATACATTATATTTCTAGAAAGG - Intergenic
1098461349 12:70736193-70736215 CAGACAATGTGCTTCTAGAATGG + Intronic
1104102127 12:125622704-125622726 CAGAAAAAAGGTTTCTGGAAAGG - Intronic
1104185635 12:126427892-126427914 CATACATTAGGTTTATATAAAGG + Intergenic
1105509298 13:21037915-21037937 CAGAGAAAAGGTTTCCAGAAGGG + Intronic
1106302184 13:28478035-28478057 CAGACACTATGATTCTAAAGAGG - Intronic
1107697437 13:43013874-43013896 CACACACTTGGTTTCCAGGAGGG + Intergenic
1109650327 13:65315122-65315144 GTCACACTAGCTTTCTAGAAAGG + Intergenic
1110533167 13:76620058-76620080 AATACACTGGGGTTCTAGAAAGG + Intergenic
1111884012 13:93995874-93995896 CAAACACTAGGTTTCCAAAGGGG - Intronic
1117839707 14:59846939-59846961 CAGACACTAGGTTTCTAGAATGG - Intronic
1119220469 14:72902308-72902330 AAGCCACCATGTTTCTAGAAAGG + Intergenic
1124457859 15:29860769-29860791 CAGACACTGAGTTTCTTAAATGG + Intronic
1124859955 15:33429798-33429820 CTGACAGTTGGTTTCTGGAAAGG + Intronic
1126415387 15:48412724-48412746 CAGGCACTGTGTTTCTGGAATGG - Exonic
1126585980 15:50287909-50287931 CAGAGACCAGATTTCAAGAAAGG - Intronic
1129292215 15:74577127-74577149 CAGATAAGAGTTTTCTAGAAAGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1137098398 16:36341131-36341153 CAAACACAGGGTTTCCAGAATGG - Intergenic
1139116159 16:63956138-63956160 CACACACTAGGCTTTTAGAGAGG - Intergenic
1146449531 17:32961440-32961462 CAGACACTTGGTGTCTATAGGGG + Intergenic
1148481678 17:47963647-47963669 TAGACACTTTGTTTCTAGTAAGG + Intergenic
1148967409 17:51447414-51447436 CAGAGAGTAGGCATCTAGAAAGG - Intergenic
1151960687 17:77403997-77404019 CACACACAAGGTTCCTAGAGTGG - Intronic
1154308228 18:13245965-13245987 CAGATACTGGCTTTTTAGAAAGG - Intronic
1156744079 18:40368421-40368443 CAGAGTCTAGCTTTCAAGAATGG + Intergenic
1158748640 18:60231675-60231697 CAGACCTTAGGTTTCAAGCAAGG - Intergenic
1161688903 19:5719582-5719604 CAGACATGAAGTTTCTCGAAGGG - Intronic
1168579674 19:57544412-57544434 CAGCCAATATGTTTCTAGAGGGG + Exonic
927705308 2:25293111-25293133 CAGAGACAAGGCTTCTGGAAGGG - Intronic
928963084 2:36949674-36949696 CTGAGGCTAGGTTTCTAGAAAGG + Intronic
932359822 2:71095048-71095070 AAAACACTATGTTTGTAGAAAGG + Intergenic
933609374 2:84417707-84417729 CACAAACTAAGCTTCTAGAATGG + Intergenic
937012593 2:118575472-118575494 CAGACTCTAAGTTTCTCAAATGG - Intergenic
937619129 2:123965423-123965445 CACCCATTAGGTTTCCAGAATGG - Intergenic
937756435 2:125544360-125544382 CACACACTGGTTTTCCAGAAAGG - Intergenic
938160637 2:128981903-128981925 CAATCACTGAGTTTCTAGAAAGG + Intergenic
939455173 2:142424841-142424863 CAGACACTAGGAATGTTGAAAGG - Intergenic
941532269 2:166685293-166685315 CAGCCACAAGATTTCTTGAAGGG - Intergenic
943106651 2:183552021-183552043 CAGAGACAAACTTTCTAGAAAGG - Intergenic
943312965 2:186350443-186350465 GAGACACTCTGTGTCTAGAAAGG - Intergenic
943757510 2:191571930-191571952 CAGACACCAGGTATCAAGTAAGG - Intergenic
945073872 2:206017375-206017397 CATTCAATAGATTTCTAGAAAGG + Intronic
946532944 2:220592539-220592561 CAGTCACTATGTTTCCAAAAGGG - Intergenic
948164017 2:235847148-235847170 GAGACTTTAGGTTTCGAGAATGG + Intronic
948229832 2:236341769-236341791 CAGAAACAAGGTTGCCAGAATGG - Intronic
948609911 2:239160276-239160298 CAGACACTTGGTCTGAAGAAAGG - Intronic
1169832216 20:9837973-9837995 CACACACATGGTTTCAAGAAGGG + Intronic
1170148675 20:13205328-13205350 CAGACACTTGATTTTGAGAAGGG - Intergenic
1172503089 20:35440984-35441006 TAGACTCTAAGTTTCTTGAAGGG + Intronic
1174890632 20:54388305-54388327 CAGACATTAAGTTTCTGAAACGG - Intergenic
1175325889 20:58128345-58128367 CAGGCACTGGGGTTCTAGCAGGG + Intergenic
1176894031 21:14354288-14354310 CAGAATTTAGGCTTCTAGAAAGG + Intergenic
1177863418 21:26483082-26483104 CAGACAGTAGTTTTTTAAAAAGG - Intronic
1181546629 22:23606139-23606161 CAGACACTAGCTTTCACTAAAGG - Intergenic
1182536750 22:31009524-31009546 CAAAGACTAGGTTACTAGGAGGG - Intergenic
1183742444 22:39676326-39676348 CAGACACTAGCAGTGTAGAACGG + Intronic
959408092 3:105986390-105986412 AAAACACTATGTTTGTAGAAAGG + Intergenic
961799140 3:129431375-129431397 CACACACTAGGCTTCTAGTTGGG + Exonic
962739599 3:138353439-138353461 GAGACACTGTGTCTCTAGAAGGG - Intronic
965841334 3:172909099-172909121 CAACCACTGGGTATCTAGAAAGG - Intronic
967527956 3:190515412-190515434 CAGACAGTGGGTTTTCAGAAAGG + Intronic
969849768 4:9947113-9947135 CACACACTTGGTTCCTAGAGGGG - Intronic
972801799 4:42483544-42483566 CAGGCACCAGGTCCCTAGAAGGG - Intronic
972935792 4:44133398-44133420 CATACGCCATGTTTCTAGAAGGG + Intergenic
976177368 4:82368368-82368390 CATACACTGAGTTTGTAGAAAGG + Intronic
978147549 4:105393625-105393647 AATACACTAGGTTTAAAGAAGGG + Intronic
981441051 4:144782479-144782501 CAGAGCCCAGGTTTCTAGAAAGG + Intergenic
982765735 4:159346410-159346432 CAGGCACTATTTTTCTAAAACGG - Intronic
984797642 4:183678619-183678641 AAAACAATAGTTTTCTAGAAAGG + Intronic
987646507 5:20679330-20679352 CATCCACTGGGGTTCTAGAAAGG + Intergenic
990653781 5:57932137-57932159 CTGAAACTAAGTTTCCAGAAGGG - Intergenic
992370092 5:76134976-76134998 CTGACACTTGGTATCTAGACTGG - Intronic
993503455 5:88686071-88686093 CAAACACGAGGATTCTAAAACGG + Intergenic
997040729 5:130250270-130250292 CAGACACTAGGACTCTAAAAGGG - Intergenic
997220334 5:132157118-132157140 CAGAGACTAGGAATCTAGAGAGG + Intergenic
997744305 5:136285645-136285667 CAGACTCTAAGGATCTAGAAGGG + Intronic
998022613 5:138783410-138783432 CAAACACTGATTTTCTAGAAAGG - Intronic
998497406 5:142602603-142602625 CACACACAAGGTGTCTAGGAGGG - Intronic
999044541 5:148452964-148452986 CAGACATTTGGTTTGCAGAATGG - Intronic
999333058 5:150691057-150691079 CAGACACCAGGTTTCTTCGATGG + Exonic
1003837815 6:10090697-10090719 CATAGACTATTTTTCTAGAAGGG - Intronic
1007206266 6:40154209-40154231 CAGAAACTAGGGGTCTAGGAAGG - Intergenic
1007934001 6:45717038-45717060 CATACAGTAGTTTTCTAGGAGGG + Intergenic
1008846491 6:55970916-55970938 CAAACATTAGGATTCAAGAAAGG - Intergenic
1009549803 6:65074569-65074591 CATACACTCTGCTTCTAGAAGGG - Intronic
1010459489 6:76097988-76098010 CAGAGACTAGGAATCTAGAGAGG - Intergenic
1012574588 6:100777577-100777599 CTTAAATTAGGTTTCTAGAAAGG + Intronic
1013433969 6:110082906-110082928 CTGGCACTAGGTTTCTAAACTGG + Intergenic
1013584213 6:111564484-111564506 CAGAAACTCAGTTTCTGGAAGGG - Intronic
1015889686 6:137957707-137957729 GAGAAACTATGTTTCTAAAATGG + Intergenic
1017186451 6:151605634-151605656 CAGACTCATGGTTTCTACAATGG - Intronic
1020035838 7:4962632-4962654 CAGAAACAAGGCTTCAAGAATGG - Intergenic
1020400083 7:7766900-7766922 CAGACAGTAAGTTTCCATAAAGG - Intronic
1021826709 7:24560738-24560760 GAGACACTAAGTTTCCAGCAGGG + Intergenic
1022316980 7:29254706-29254728 CACATACTAGGTCTCTAGGAGGG + Intronic
1031770179 7:125832508-125832530 TGGACACAAGTTTTCTAGAATGG + Intergenic
1033525636 7:142210630-142210652 CAGACAGGAGGAATCTAGAAAGG - Intronic
1038610995 8:29060076-29060098 CAGACCCCCGGTTTCTAGAGAGG - Intronic
1041153495 8:54960462-54960484 CAGACAGCAGGTTTCTGGGATGG + Intergenic
1041496180 8:58487626-58487648 CAGATAGGAGGTTTCTAGATTGG + Intergenic
1042009576 8:64226491-64226513 CATACAGCAGGTTTCTAGACTGG + Intergenic
1043793752 8:84508902-84508924 TTGTCACTAGGTTTTTAGAAAGG + Intronic
1045118591 8:99011872-99011894 CAGAAACTAGATTTCTTAAAAGG - Intergenic
1045537478 8:103045453-103045475 CAGACACTTGGCTCTTAGAATGG + Intronic
1046624287 8:116560497-116560519 CAGACACCAGGTTTCTTGGCAGG - Intergenic
1047237849 8:123057965-123057987 CATAGATTAGGTTTCTAAAAGGG - Intronic
1048533587 8:135272831-135272853 CAGACCTTAGGTTTCCACAAAGG - Intergenic
1050125203 9:2349376-2349398 CAGAAACTAGGTTTTTTAAAAGG - Intergenic
1052109962 9:24569549-24569571 GAGACACTACTTTACTAGAATGG - Intergenic
1057326129 9:94065871-94065893 CAGCCACTAGACATCTAGAAGGG - Intronic
1059247268 9:112859147-112859169 TAGATACGAGGTATCTAGAATGG - Intronic
1060464509 9:123891010-123891032 CAGACACTATGGTTTTTGAAGGG - Intronic
1060978602 9:127779633-127779655 CAGTCACCTGATTTCTAGAATGG + Intergenic
1187186542 X:16992102-16992124 CAGAGACTAGGTTTCAACATAGG - Intronic
1187685508 X:21811929-21811951 AAGCCACTAGATTTTTAGAATGG - Intergenic
1189095722 X:38136997-38137019 CAAACACAAGGTTTCTAGTTGGG - Intronic
1192695717 X:73413857-73413879 CAAACACTATGTTTCTGCAAAGG - Intergenic
1193493284 X:82177372-82177394 CAGACACTAGGTATTATGAAAGG - Intergenic
1194439797 X:93918194-93918216 TAGACACTAGTTTAGTAGAATGG - Intergenic
1195531861 X:105967028-105967050 CATTCACTAGGGTTATAGAAAGG + Intergenic
1196197347 X:112850064-112850086 GACACACTATGCTTCTAGAAAGG - Intergenic
1197960550 X:132000859-132000881 GAGACACAAGGTTTCTAGACTGG + Intergenic
1199052746 X:143256735-143256757 CAGCAGCTAGCTTTCTAGAAAGG - Intergenic
1200832294 Y:7698902-7698924 CTGACACTAGTTATGTAGAATGG - Intergenic
1201050809 Y:9933010-9933032 CATTCATTAGGTTTTTAGAATGG - Intergenic