ID: 1117842091

View in Genome Browser
Species Human (GRCh38)
Location 14:59870556-59870578
Sequence GGTCCCAGTGGCTCAGGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117842091_1117842103 11 Left 1117842091 14:59870556-59870578 CCGGTGCCTGAGCCACTGGGACC 0: 1
1: 0
2: 2
3: 33
4: 243
Right 1117842103 14:59870590-59870612 AGCGGCAGCAGCTCGTCCTGCGG 0: 1
1: 0
2: 1
3: 23
4: 179
1117842091_1117842098 -7 Left 1117842091 14:59870556-59870578 CCGGTGCCTGAGCCACTGGGACC 0: 1
1: 0
2: 2
3: 33
4: 243
Right 1117842098 14:59870572-59870594 TGGGACCCGGGGCCGGCCAGCGG 0: 1
1: 0
2: 2
3: 24
4: 252
1117842091_1117842104 20 Left 1117842091 14:59870556-59870578 CCGGTGCCTGAGCCACTGGGACC 0: 1
1: 0
2: 2
3: 33
4: 243
Right 1117842104 14:59870599-59870621 AGCTCGTCCTGCGGATCCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
1117842091_1117842105 25 Left 1117842091 14:59870556-59870578 CCGGTGCCTGAGCCACTGGGACC 0: 1
1: 0
2: 2
3: 33
4: 243
Right 1117842105 14:59870604-59870626 GTCCTGCGGATCCCCCGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117842091 Original CRISPR GGTCCCAGTGGCTCAGGCAC CGG (reversed) Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900582661 1:3416723-3416745 GGGCCCTGTGGGTCAGGCATTGG + Intronic
900609142 1:3537129-3537151 GTTCCTAGGGGCTCAGGCATGGG + Intronic
900678951 1:3905597-3905619 GGCCCCAGGGGCGCAGGCATTGG - Intergenic
900732083 1:4268725-4268747 TGTCCCACTGGCTCAGGCAGCGG + Intergenic
900778290 1:4600707-4600729 GGTGTCTGTGCCTCAGGCACTGG - Intergenic
901013457 1:6213876-6213898 GGGCCCAGTGACTCAGAGACAGG - Intronic
901533542 1:9868123-9868145 GGTCTGTGTGGCTCAGGCCCCGG + Intronic
901642839 1:10701765-10701787 GGTCCTAGGGGCTCAGCCCCAGG - Intronic
901835821 1:11923364-11923386 GCTCCCTGTGGCTCAGGGAGGGG + Exonic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
903813228 1:26046260-26046282 GGCCCCATGGGCGCAGGCACAGG - Intergenic
904210628 1:28884800-28884822 GGTCCCAGGGCCTGAGGCCCAGG + Intergenic
904431622 1:30468202-30468224 GGTCCAAGTGGTCCAGGCAGAGG - Intergenic
904477743 1:30775753-30775775 AGTCACTGTGGCTCAGGCACTGG - Intergenic
905640986 1:39589709-39589731 GGTCCCAGGTGCTCAGGAACTGG - Intergenic
906258064 1:44365801-44365823 GGGCCCAGTGGCTAAGGCTGCGG - Intergenic
907509258 1:54946205-54946227 GGACCCACTGGGGCAGGCACGGG - Intergenic
908405664 1:63811835-63811857 GGTCTGGGTGGCTCAGGCAGTGG + Intronic
916936526 1:169633543-169633565 GGTACCAGTGCCCAAGGCACAGG - Intergenic
921065482 1:211619565-211619587 GGCCTCAGTGGCCCAGGCAGTGG + Intergenic
923436370 1:233971438-233971460 GGGCGCGGTGGCTCACGCACAGG + Intronic
1062941002 10:1421342-1421364 GGTCTCAGTGTCTCAGGGTCAGG + Intronic
1064318339 10:14278366-14278388 GTTCCCAGAGGCTCAGGCTCCGG + Intronic
1065010597 10:21417339-21417361 GGGCCCAGGGGCCCAGGGACAGG - Intergenic
1066200982 10:33142425-33142447 GCTCCCAGGGGCTGAGGCTCTGG + Intergenic
1067778139 10:49177593-49177615 GGAGCCAGTGACTCAGGCTCAGG - Intronic
1069776486 10:70930183-70930205 GGGCTCAGAGGCACAGGCACTGG + Intergenic
1070307188 10:75246576-75246598 GCCCCCAGTGGCTCAGGCTAGGG + Intergenic
1073745867 10:106467554-106467576 GGACCCAGTGAGCCAGGCACGGG - Intergenic
1073927350 10:108532795-108532817 GGACCCACTGAGTCAGGCACTGG - Intergenic
1075645255 10:124092583-124092605 GGTCCCACGGGCTTAGGCGCGGG + Intronic
1075690550 10:124391108-124391130 GGTCCTGGTGCCTCAGGGACTGG - Intergenic
1076218929 10:128717668-128717690 GGTCCCAGAGGCCCAGGCTCAGG + Intergenic
1076476055 10:130752228-130752250 GGTGCCTGAGGCTCTGGCACAGG + Intergenic
1076618442 10:131771779-131771801 GGCACCAGTGGCTCCGGCCCAGG - Intergenic
1076982357 11:211375-211397 TCCCCCAGTGGCTCTGGCACTGG + Intronic
1077022008 11:421094-421116 GGGAGCAGTGGCTCAGGGACAGG + Intronic
1078484145 11:11706222-11706244 GATCTTAGTAGCTCAGGCACTGG - Intergenic
1079121457 11:17688193-17688215 GGGCCCTGTGACTCAGGCGCGGG - Intergenic
1079333388 11:19551486-19551508 GGTGCAAGTGGATCAGGGACAGG - Intronic
1080457161 11:32428148-32428170 GGCCCCAGTGCCCCAGGCTCAGG - Intronic
1080695610 11:34600708-34600730 GGACCCAGAGGCACAGCCACTGG - Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081673013 11:44951924-44951946 GGTCACAGTGGGCCAGGAACCGG + Intergenic
1081931546 11:46875012-46875034 GATGCCAGTGGGGCAGGCACAGG + Exonic
1082858698 11:57833058-57833080 GCTCCATGTGGCTGAGGCACAGG + Intergenic
1083882218 11:65554242-65554264 GGTACCGGCGGCTCAGGCCCCGG - Exonic
1084295309 11:68209786-68209808 GGTACACGTGGCTCAAGCACTGG - Intronic
1085519612 11:77130406-77130428 GGTGACAGTGGCTGAGGCTCAGG + Intronic
1087245095 11:95825891-95825913 GGGCGCAGTGGCTCAGCCACTGG - Intronic
1089773605 11:120820635-120820657 GGTGCCTGGGGCTCAGGCACTGG - Intronic
1091587415 12:1824151-1824173 GGTCCTGGAGGCTCAGGGACAGG + Intronic
1093015527 12:14150940-14150962 GGACCCAGTGTCACAGGCCCTGG + Intergenic
1097190324 12:57216589-57216611 GGGTCGAGGGGCTCAGGCACTGG - Intergenic
1098362043 12:69664401-69664423 CTTCCCTGTAGCTCAGGCACTGG + Intronic
1098362046 12:69664405-69664427 GGTCCCAGTGCCTGAGCTACAGG - Intronic
1102454013 12:113060483-113060505 GGTGCCAGTGTCCCAGGCAGAGG + Intronic
1103339170 12:120212119-120212141 GGGCCCAGAGGCTCTGGCAGGGG + Exonic
1103977835 12:124715270-124715292 GGTCCCCTTGTCTCAGGAACAGG - Intergenic
1104553915 12:129782565-129782587 TTTCCCAGTGGCTGGGGCACAGG - Intronic
1105694303 13:22872723-22872745 GGTCACAGTGGCCCTGGCCCTGG - Intergenic
1107851042 13:44574004-44574026 GATTCCTGTGGCTCAGCCACAGG - Exonic
1112604591 13:100891332-100891354 AGTCCCAGCGGCTCAGGAGCCGG + Intergenic
1113408720 13:110065176-110065198 GGTCCCACTGGCTAAGACAGAGG + Intergenic
1113671812 13:112180808-112180830 GGTCTTCGTGGCTCAGGCAGAGG + Intergenic
1114549582 14:23525261-23525283 GGTCCCAGAGCCTGAGGCAGGGG - Exonic
1115657587 14:35458928-35458950 TGTTCCAGAGGCTCAGGCCCAGG - Intergenic
1116190730 14:41662132-41662154 GTTCTCAGAGGCTCAGGCCCAGG - Intronic
1117135398 14:52730299-52730321 GGTCCCAGTGACTCCAGCAGCGG - Exonic
1117668175 14:58078826-58078848 GGTCCCATTGGCTTAGGCCAGGG - Intronic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118315407 14:64722914-64722936 GGTCCCATTGCCTCAGTGACAGG + Intronic
1118574796 14:67231546-67231568 GGACCCAGTGGCTCAGGCTGAGG - Intergenic
1119910499 14:78345544-78345566 GCTCCCAGAGGCTCAGACAAAGG + Intronic
1121506717 14:94483321-94483343 GGTGCCAGTGGCGCTGGCAGGGG - Intergenic
1121616227 14:95315512-95315534 TGTTCCACTGGCTCAGGCCCAGG - Intronic
1121669410 14:95696378-95696400 GGGCCCAGAGGCTCTGGCCCAGG + Intergenic
1122612948 14:102998577-102998599 GGACTCAGTGGCTGAGTCACTGG + Intronic
1123468064 15:20530666-20530688 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1123650049 15:22470376-22470398 GGTACCTGTGGCTCAGGCTCAGG - Intergenic
1123728379 15:23125875-23125897 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1123740455 15:23279218-23279240 GGTACCTGTGGCTCAGGCTCAGG - Intergenic
1123746543 15:23323340-23323362 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1124203546 15:27698509-27698531 GGTCACAGGGGCTCAAGCAAAGG + Intergenic
1124278810 15:28346657-28346679 GGTACCTGTGGCTCAGGCTCAGG + Intergenic
1124303889 15:28564951-28564973 GGTACCTGTGGCTCAGGCTCAGG - Intergenic
1124532772 15:30521428-30521450 GGCACCTGTGGCTCAGGCTCAGG - Intergenic
1124724679 15:32145715-32145737 GGTCCCACTGGGCCAGGCACAGG + Intronic
1124765882 15:32486216-32486238 GGCACCTGTGGCTCAGGCTCAGG + Intergenic
1124786705 15:32688398-32688420 TATCCCCGTGGCTCAGGCTCTGG - Intronic
1127500369 15:59549054-59549076 TTGCCCAGTAGCTCAGGCACAGG + Intergenic
1127676090 15:61240733-61240755 GTTCCCAGTGACTCATGCGCAGG - Intergenic
1127844646 15:62858465-62858487 GGACCCTGTGGGTCAGGCATGGG + Intergenic
1128220027 15:65962558-65962580 TGTGCCAGGGGCTCAGTCACTGG + Intronic
1128727838 15:70000823-70000845 GGTGCCAGTCGCCCAGGCCCAGG + Intergenic
1128787748 15:70410705-70410727 GGGCCCTGAGGCTCAGGCAGGGG - Intergenic
1128812129 15:70580396-70580418 GGACCCACCGGCTCAGCCACTGG - Intergenic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129413867 15:75364077-75364099 CTTCCCAGTGGCCCAGGCCCTGG - Exonic
1132674082 16:1114534-1114556 GCCCCCAGTGGCTCAGGCCTGGG - Intergenic
1134531687 16:14989005-14989027 GCTCCCTGTGGCTCAGGGAGGGG + Intronic
1135296370 16:21283093-21283115 ACTTCCAGAGGCTCAGGCACAGG - Intronic
1136544191 16:30946845-30946867 GGGCGCAGTGGCTCAGGTCCAGG - Exonic
1137494572 16:48959872-48959894 GGTCCCAGTGGGTCTGAGACTGG + Intergenic
1137576767 16:49605098-49605120 GGACCCAGTGGCCCAGACCCAGG - Intronic
1141124563 16:81391935-81391957 CGTCCCTCTGTCTCAGGCACTGG - Intergenic
1142850390 17:2701811-2701833 GGTCCGGGTGCCTCAGGCCCAGG + Intronic
1142943351 17:3402379-3402401 GGTCCCTGAGGCTCAGGGATGGG - Intergenic
1144960124 17:19040075-19040097 GGTCGCATTTGCTCAGGCAGGGG - Intronic
1144975036 17:19134449-19134471 GGTCGCATTTGCTCAGGCAGGGG + Intronic
1147450680 17:40502032-40502054 GGTCACACTGGGACAGGCACAGG + Intergenic
1148097224 17:45060926-45060948 GCTCCCAGCGGCCCAGGCACTGG + Exonic
1148241227 17:46000585-46000607 GGTCCAGGAGGCTCGGGCACTGG - Intronic
1148695621 17:49556435-49556457 GGTCCCTGTAGCCCAGGCCCTGG - Intergenic
1150247939 17:63690089-63690111 GGTCCGAGTGACTAGGGCACTGG + Intronic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1152029250 17:77831384-77831406 GATCCCAGGGGCACAGGCAGGGG - Intergenic
1152093553 17:78259581-78259603 GGTCTGAGTGGCTATGGCACGGG - Intergenic
1152347648 17:79763231-79763253 GGCCACAGTGGCTCAGGGCCGGG + Intergenic
1152604297 17:81281335-81281357 GGTCCCAGGGGCTCGGGTCCTGG + Intronic
1153626041 18:7023262-7023284 GGTCACTGTGACTCAGTCACCGG - Exonic
1153717897 18:7869314-7869336 GGCCCTGGTGGCACAGGCACCGG + Intronic
1154361691 18:13668244-13668266 GGTTCCAGTGGTTCAGGGGCTGG - Intronic
1157177058 18:45461192-45461214 GGTCACAGTGGCTCAAACAGAGG + Intronic
1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG + Intronic
1160228678 18:77030109-77030131 GTCCCCAGAGGCTCAGGCAATGG + Intronic
1160590883 18:79944113-79944135 AGAACCAGTGGCCCAGGCACTGG + Intronic
1160766644 19:811676-811698 CCGCCCAGTGGGTCAGGCACAGG + Exonic
1160838010 19:1133484-1133506 GGCCCCAGTGGGGCTGGCACAGG - Intronic
1160944315 19:1634091-1634113 GGCCGCAGTGCCTCTGGCACAGG - Intronic
1161041529 19:2113153-2113175 GGTCCCAGTGGGCCAAGCAGGGG - Intronic
1161304168 19:3557643-3557665 GCTCCGATTGGCTCAGGCACCGG - Intronic
1161650246 19:5479977-5479999 GGTCCCAGAGCCCCAGCCACCGG + Intergenic
1166308075 19:41946538-41946560 GGTCGCTGTGGCTGGGGCACAGG - Intergenic
1166321889 19:42023766-42023788 GATACCAGTGGCCCAGGCCCGGG - Intronic
1166739589 19:45105793-45105815 AGTCCCAGGGGGTCAGGCCCGGG + Intronic
1167050027 19:47072454-47072476 GGGGACAGTGGCTCATGCACCGG + Exonic
1167520174 19:49950098-49950120 GCTCCCAGAGCCTCAGGCCCTGG + Exonic
1167590456 19:50401944-50401966 GGCTCCAGTGGCTCAGGGAGGGG - Intronic
1167593231 19:50415447-50415469 GGGCGCGGTGGCTCACGCACAGG + Exonic
1168510894 19:56972903-56972925 GGTGCCAGTGGCTCAGTCCCTGG + Intergenic
926742736 2:16125936-16125958 GGTCCCTGTGGTGGAGGCACAGG - Intergenic
928494687 2:31819955-31819977 GGTCACAGTGGTTCAGGGAGTGG + Intergenic
929816559 2:45237519-45237541 GGACCCAGTGGCACAGCCACGGG + Intergenic
930464649 2:51731992-51732014 GGTCACAGTGGCTGGGGCAGAGG + Intergenic
932366177 2:71154928-71154950 GGTAGCTGTGGCTCAGGCTCAGG - Intergenic
932818233 2:74878638-74878660 GGCCACAGTGGGTCAGACACAGG + Intronic
933151087 2:78916066-78916088 GGTCCAAGGAGCTAAGGCACAGG + Intergenic
933759683 2:85665109-85665131 GGACCCTGGGGCTCAGGCTCAGG - Intronic
936035474 2:109107615-109107637 GGTCCTAATGGCTCAGTCTCAGG + Intergenic
942462631 2:176178713-176178735 GGTCACTGTGGCTCAGGGGCGGG - Intergenic
944677465 2:202046207-202046229 GGTGTCAGTGGCTCAGGAACAGG - Intergenic
946201678 2:218074117-218074139 GGGCCCAGTGGCTCCGGCAGAGG - Intronic
946336577 2:219041441-219041463 GGTCCCAGGGTCTCAGGGAGCGG - Intronic
946399668 2:219461699-219461721 GGTTCCAGGGGCTCAGGGAGGGG + Intronic
947848502 2:233264826-233264848 GGTCCGTCTGGCTCTGGCACAGG + Intronic
948121478 2:235534174-235534196 GACCCCGGTGGCTCAGGCAAAGG + Intronic
948284945 2:236776762-236776784 GGTTCCAGTGGGGCAGACACAGG - Intergenic
1169115194 20:3059867-3059889 TCTCCCAGAGGCCCAGGCACTGG + Intergenic
1169329597 20:4706036-4706058 GAAGCCAGTGTCTCAGGCACAGG - Intergenic
1170670704 20:18430297-18430319 GGCACCTGTGACTCAGGCACAGG + Intronic
1170697699 20:18674743-18674765 GGTCCCAGGGGCAGAGGCAGGGG - Intronic
1171444729 20:25195607-25195629 GGACCCAGTTGCGCAGGCGCGGG - Intergenic
1172314048 20:33939861-33939883 TTTCCCAGTGGCTCAGGCATGGG + Intergenic
1172789974 20:37496362-37496384 TGTCCCAGTGGATTAGGCATTGG + Intronic
1173160139 20:40646481-40646503 GGCCCCAGGGGCTCAGGGCCAGG + Intergenic
1175193811 20:57228715-57228737 GGTCCCAGGGGCTCAGGCCTGGG + Intronic
1178978384 21:37240418-37240440 GGGCGCAGTGGCTCAGGGCCAGG - Intronic
1179435858 21:41361695-41361717 GCTCAGAGTGGCTCAGTCACTGG - Intergenic
1179971255 21:44837608-44837630 GGTCCCTGTGGCCACGGCACAGG + Intergenic
1181166642 22:20987500-20987522 GGTCCCAGTGGTAAAGGCCCTGG - Exonic
1181563266 22:23717745-23717767 GGTCCCAGAGGCCCAGGGTCAGG - Intergenic
1184079998 22:42212650-42212672 GGACCCAGGGGCTCACTCACTGG - Exonic
952308204 3:32163890-32163912 TGGCCCAGTGGCTCTGGCTCTGG + Intronic
953118294 3:40014513-40014535 GGTCCAAGTGTCCCAGGTACAGG - Intronic
954087449 3:48256473-48256495 GACCCCAGTGGGTCAGGTACTGG + Intronic
954100313 3:48367411-48367433 GTTCCCAGTAGCACAGGCACTGG + Intergenic
954631920 3:52052406-52052428 GGGCCCCATGGCTAAGGCACTGG + Intronic
955029719 3:55204575-55204597 GATCCCAGGGGTTCAGGCTCTGG + Intergenic
958622264 3:96576394-96576416 GGGCCCAGTGGGGTAGGCACCGG + Intergenic
961221217 3:125201652-125201674 GGTCCCAGCTACTCAGGCCCAGG + Intronic
961439549 3:126944800-126944822 GGGCCCAGTGGCCCAGGCGTGGG + Intronic
962318377 3:134372789-134372811 GCTCCCAGTGGTTCATGGACTGG + Intronic
963947679 3:151164097-151164119 GGGCACAGTGGGTCAAGCACAGG + Intronic
966732557 3:183162869-183162891 GGTCCCAGAGGCCCGGGCCCCGG - Exonic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
968632587 4:1659656-1659678 GGTCCCACAGGCTCAGGCAGGGG + Intronic
969084218 4:4643356-4643378 GGCCCCAGAGGCACAGACACTGG - Intergenic
969337000 4:6516946-6516968 TGTCCCAGAAGCTCAGGAACTGG + Intronic
972498268 4:39653920-39653942 GGTCCCTCTGGCTCAGCCACTGG - Intergenic
975992039 4:80267273-80267295 GGTCCCAGTGGCCTGGGCTCAGG - Intronic
976506480 4:85853269-85853291 GGTCCCACTGAGCCAGGCACAGG + Intronic
976564524 4:86538439-86538461 GGGCGCAGTGGCTCAGGGCCGGG - Intronic
981023382 4:140051887-140051909 TGGCCCAGTGGCTAAGTCACGGG - Intronic
985483751 5:137238-137260 GGTGCCAGGGGCTCAGGGGCAGG + Intergenic
985494102 5:194951-194973 GGTGGCAGGGGCTCAGGCCCAGG - Exonic
985523345 5:389374-389396 GATCCGAGTCGCTCGGGCACCGG - Intronic
985815311 5:2124102-2124124 TGTCCCAGTGTCTCTGGCATGGG + Intergenic
986229771 5:5852655-5852677 GGTCCAAGTGCCTCAGGCGAGGG + Intergenic
986298339 5:6457743-6457765 GGACCAGGTGGCTCTGGCACTGG - Intronic
991480746 5:67076617-67076639 GGAACCAGTGGCTGTGGCACTGG - Intronic
995860144 5:116632362-116632384 GTTCCCAGAGGCTCTGGCATTGG - Intergenic
997359932 5:133288627-133288649 GGGCCAAGGGGCTCAGGCAGAGG - Intronic
997472390 5:134124160-134124182 GGTCCCAGGGGCTTTGGCAGGGG + Intronic
1001200455 5:169711329-169711351 GGTACCAGTGGGTCATTCACTGG + Intronic
1002028798 5:176413488-176413510 GCTCCCTGTGGCTCCAGCACAGG + Intronic
1002302682 5:178266414-178266436 GGTCCCAGTGTCCCAGTCATCGG - Intronic
1002442722 5:179272766-179272788 GGTCTCAGTGGCTCAGAAATGGG - Intronic
1002519889 5:179786542-179786564 CTTCCCAGTGGGTCAGACACAGG + Intronic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1003233457 6:4275338-4275360 AGTCCCAGTGTGTAAGGCACTGG - Intergenic
1003512065 6:6790042-6790064 GACCCCTGTGGCTCAGTCACAGG + Intergenic
1006798991 6:36747720-36747742 GCTCCTAGTGACTCAGCCACAGG + Intronic
1007419786 6:41712628-41712650 GGGCCCAAGGGCTCAAGCACTGG + Intronic
1008035806 6:46743918-46743940 GGTCCCATTGGCTCAAGCACTGG - Intergenic
1008424655 6:51343137-51343159 GCTCCCTGTGTGTCAGGCACTGG - Intergenic
1013964159 6:115935369-115935391 GGCCCCAGTGGCGTAGGCACCGG - Exonic
1014673706 6:124339044-124339066 GGACCCAGTGGCTCACGGGCTGG + Intronic
1018320986 6:162608363-162608385 GGACCCTGTGGCTCAAGGACAGG + Intronic
1018964672 6:168475373-168475395 GGTGCCAATGTCCCAGGCACAGG + Intronic
1019156636 6:170043677-170043699 GGTCCCACTGGCTGAGATACTGG + Intergenic
1019478272 7:1254550-1254572 GGTCCCAGAGGACCAGGCTCTGG - Intergenic
1019625304 7:2012854-2012876 GGGCACAGAGGCTCAGGCACTGG - Intronic
1020128377 7:5545777-5545799 GGGCCAAGAGGCTCAGTCACTGG - Intronic
1020287589 7:6696857-6696879 GGATCCACTGGCTTAGGCACAGG + Intronic
1022124213 7:27340158-27340180 GGTCCCAATGGCCCAAGGACTGG + Intergenic
1022171680 7:27837642-27837664 GGTCCCAGAGGTGGAGGCACTGG + Intronic
1022762074 7:33365725-33365747 GGTTCCTGTGCCCCAGGCACTGG - Intronic
1025145718 7:56500969-56500991 GTTCACAGTGGCATAGGCACTGG + Intergenic
1025738821 7:64180072-64180094 GCTCACAGTGGCATAGGCACTGG + Intronic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1027173505 7:75889056-75889078 GGGCCCAGTGGGTCAGGAATGGG + Intergenic
1031141659 7:117949477-117949499 GGTCTCAGTGGCTCACCCAGTGG - Intergenic
1031141885 7:117951559-117951581 GGTCTCAGTGGCTCACCCAGTGG - Intergenic
1032026099 7:128443918-128443940 GGTCACAGTGGCCCAGCCTCCGG + Intergenic
1034302480 7:150028815-150028837 GGGCCCAGTGGCCCCGGCATTGG - Intergenic
1034348256 7:150400011-150400033 GGTCCCTGTGACTCAGGTGCCGG + Intronic
1034686137 7:152972975-152972997 GGTACCTGTGGGTCAGGCAGAGG + Intergenic
1035464187 7:159064257-159064279 GGCCCCAGTGGCTCCGGGGCAGG - Intronic
1035764231 8:2092578-2092600 GGTCCCTGTGGCCCTGGCACAGG + Intronic
1036131792 8:6121603-6121625 GTTCCCACTGGCTCAGGAGCTGG - Intergenic
1036553728 8:9838689-9838711 GGCCCTGGTGGCTTAGGCACTGG - Intergenic
1036646664 8:10615136-10615158 GATCACTGTGGGTCAGGCACTGG - Intronic
1039284513 8:36026387-36026409 GGTCCTGGTGGCATAGGCACTGG - Intergenic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1039560699 8:38510371-38510393 GGTCCCAGGGGCTCAGGGTGTGG + Intergenic
1041252980 8:55952913-55952935 GGACCCAGAGTCTCAGGCCCAGG - Intronic
1041778773 8:61554828-61554850 GGTCCCAGCTACTCAGGCCCAGG - Intronic
1041819626 8:62016085-62016107 TGTTTCAGAGGCTCAGGCACTGG + Intergenic
1042530490 8:69810102-69810124 GGTTCCAGTGCCCCAGGCCCAGG + Intronic
1042667798 8:71225460-71225482 GATACCTGTGGCTAAGGCACAGG + Intronic
1044751912 8:95424174-95424196 GGTCCCAGGCCCTCAGGCAAAGG + Intergenic
1046087911 8:109462182-109462204 GGAGATAGTGGCTCAGGCACAGG - Intronic
1046277766 8:111985611-111985633 GGCCCCGGTGGCGTAGGCACCGG - Intergenic
1048112928 8:131487454-131487476 TCACCCAGTGGATCAGGCACCGG - Intergenic
1048279405 8:133094052-133094074 GCTCCCCGTAGCTCAGACACTGG - Intronic
1049610157 8:143551366-143551388 GGACACAGTGGCTCAGGCCTGGG - Intergenic
1049782403 8:144434974-144434996 GGAGCCAGGGCCTCAGGCACCGG - Intronic
1049807358 8:144547047-144547069 GGACCCCGTGGGCCAGGCACAGG - Intronic
1051770035 9:20567680-20567702 GGTCCCAGTGACCAAGACACAGG + Intronic
1052134037 9:24888769-24888791 GATCCTGGTGGCTTAGGCACTGG - Intergenic
1052198556 9:25748213-25748235 GGTCCTAGAGGCGCAGACACAGG + Intergenic
1053299099 9:36936204-36936226 GGACCCAGTGGCCCAGGACCCGG + Intronic
1053751725 9:41263797-41263819 GGACCCAGTGAATCAGGCACAGG + Intergenic
1054257252 9:62828126-62828148 GGACCCAATGAATCAGGCACAGG + Intergenic
1054334065 9:63787599-63787621 GGACCCAATGAATCAGGCACAGG - Intergenic
1054460388 9:65459184-65459206 GGTCCCAGCATCCCAGGCACGGG + Intergenic
1057173506 9:92977534-92977556 GCTCACAGTGGTCCAGGCACCGG - Intronic
1058627852 9:106953843-106953865 GGTCCCAAGGGCTCTGGCAAAGG - Intronic
1059168102 9:112098082-112098104 GGTCCCACAGTGTCAGGCACTGG - Intronic
1060182731 9:121545579-121545601 GATCCCAGGGCCTCAGGGACTGG + Intergenic
1062032905 9:134370086-134370108 GGTCCCAGGGAGTCAGGCAGTGG - Intronic
1062538253 9:137030305-137030327 GGTCCCCGAGACACAGGCACGGG - Exonic
1062583009 9:137236638-137236660 GGGGCCTGGGGCTCAGGCACAGG + Intergenic
1187995362 X:24920372-24920394 GGTCCAAGTGGCTGAAGCACAGG - Intronic
1193723998 X:85019556-85019578 GGTACCAGTGCTTAAGGCACAGG + Intronic
1195355789 X:104038859-104038881 TGAGCCAGTGGCTCAGGCCCAGG + Intergenic
1202041214 Y:20686016-20686038 GAATCCAGAGGCTCAGGCACTGG + Intergenic