ID: 1117842406

View in Genome Browser
Species Human (GRCh38)
Location 14:59873413-59873435
Sequence GGCTGGAAAGAATTTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117842406_1117842409 14 Left 1117842406 14:59873413-59873435 CCAAGATGAAATTCTTTCCAGCC No data
Right 1117842409 14:59873450-59873472 ACCTAACATCTCTACAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117842406 Original CRISPR GGCTGGAAAGAATTTCATCT TGG (reversed) Intergenic
No off target data available for this crispr