ID: 1117861020

View in Genome Browser
Species Human (GRCh38)
Location 14:60092471-60092493
Sequence CTTGGCTCTCCGCACAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117861020 Original CRISPR CTTGGCTCTCCGCACAGGCT TGG (reversed) Intronic