ID: 1117864881 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:60136751-60136773 |
| Sequence | GGTGGTTCTGGCCCTTGTTG TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 193 | |||
| Summary | {0: 1, 1: 6, 2: 12, 3: 18, 4: 156} |
Found 0 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
|---|
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1117864881 | Original CRISPR | GGTGGTTCTGGCCCTTGTTG TGG | Exonic | ||