ID: 1117866606

View in Genome Browser
Species Human (GRCh38)
Location 14:60156098-60156120
Sequence ACTGGAGCCTCGAGTGGAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117866606_1117866614 19 Left 1117866606 14:60156098-60156120 CCAATTCCACTCGAGGCTCCAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1117866614 14:60156140-60156162 GTCAGCTCCCATTCTATGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 100
1117866606_1117866613 15 Left 1117866606 14:60156098-60156120 CCAATTCCACTCGAGGCTCCAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1117866613 14:60156136-60156158 ATCAGTCAGCTCCCATTCTATGG 0: 1
1: 0
2: 1
3: 10
4: 113
1117866606_1117866617 30 Left 1117866606 14:60156098-60156120 CCAATTCCACTCGAGGCTCCAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1117866617 14:60156151-60156173 TTCTATGGAAGGAATGTAAATGG 0: 1
1: 0
2: 3
3: 34
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117866606 Original CRISPR ACTGGAGCCTCGAGTGGAAT TGG (reversed) Exonic
900931328 1:5739732-5739754 GCTGCTGCCTCGAGTGGGATGGG + Intergenic
907663394 1:56414035-56414057 ACATGAGCATGGAGTGGAATGGG - Intergenic
911040006 1:93583885-93583907 CCTGCAGCCTGGAGGGGAATGGG - Intronic
913608625 1:120489726-120489748 TCTGGACCCTCCAGTGGACTTGG + Intergenic
914370366 1:147019504-147019526 TCTGGACCCTCCAGTGGACTTGG + Intergenic
914484328 1:148093906-148093928 TCTGGACCCTCCAGTGGACTTGG - Intergenic
922765636 1:228155283-228155305 TCTGGAGCCAGGCGTGGAATGGG + Intronic
922949028 1:229542711-229542733 ACTGGAGCGTGGAGCAGAATGGG - Intronic
1064081022 10:12308130-12308152 ACTGGAGCCTGGAGAGGGAAAGG - Intergenic
1074689129 10:115988473-115988495 ACTGGAGGCTAGAGGGGAGTAGG + Intergenic
1075065215 10:119284847-119284869 ACTGGGGCCTCTCGTGGAAATGG + Intronic
1076318524 10:129561377-129561399 TCTGGGGTCTCGTGTGGAATGGG - Intronic
1076428302 10:130383034-130383056 AGTGGAGCCTACAGTGGCATGGG + Intergenic
1076795741 10:132797395-132797417 ACCGGTGCCTCGTGAGGAATTGG + Intergenic
1080645625 11:34185666-34185688 ACTGGAGGCTGGAGTGGGGTTGG + Intronic
1082580689 11:54864298-54864320 ACTGAAGCCTAGAGTGAAAAAGG - Intergenic
1082696589 11:56373750-56373772 ACTGGAGAGTTGAGTGGAACCGG + Intergenic
1087786324 11:102358679-102358701 ACTGTATCCTCTTGTGGAATTGG + Intronic
1088704792 11:112452264-112452286 ACAGGTGCTTGGAGTGGAATGGG - Intergenic
1088720419 11:112587387-112587409 ACTGAAGCCTGGAGTGGTAGGGG + Intergenic
1091458639 12:627561-627583 ATTGGAGCCTCGAATGGGTTGGG + Intronic
1097233954 12:57527405-57527427 ACTGAAGCCTCAAGTGAGATAGG - Intronic
1101752714 12:107596200-107596222 ATTGGATCCTTGACTGGAATAGG - Intronic
1110707719 13:78613807-78613829 ACTGCAGCCTCGGGTGGGCTGGG - Intergenic
1114653054 14:24299048-24299070 ACTGGTGCCTCCAGGGGTATTGG - Exonic
1117866606 14:60156098-60156120 ACTGGAGCCTCGAGTGGAATTGG - Exonic
1120512549 14:85433144-85433166 ACTGGGGCCTGTTGTGGAATGGG + Intergenic
1122317308 14:100833769-100833791 ACTGGAGCCTAAAGTTTAATTGG - Intergenic
1124487130 15:30128424-30128446 TTTGGAGCCTCAAGAGGAATTGG + Intergenic
1124542216 15:30597399-30597421 TTTGGAGCCTCAAGAGGAATTGG + Intergenic
1124756395 15:32409899-32409921 TTTGGAGCCTCAAGAGGAATTGG - Intergenic
1132469333 16:93173-93195 CCTGGAGCCCCGAGTGGGAAGGG - Intronic
1132539829 16:503525-503547 CCTGGGGCCTTGAATGGAATGGG + Intronic
1137793612 16:51196299-51196321 CCTGGAGCCCTGAGTGAAATAGG + Intergenic
1144480994 17:15628891-15628913 CCTGGAGCCTCCAATGGAACGGG - Exonic
1144917370 17:18735162-18735184 CCTGGAGCCTCCAATGGAACGGG + Exonic
1144919515 17:18751697-18751719 GCTGGAGCCTCCAGAGGCATGGG - Intronic
1147190271 17:38734334-38734356 CCTGGGGCCTAGAGTGGAAGTGG - Exonic
1148050225 17:44766503-44766525 AGAGGAGCCTCGGGTGGAAGGGG + Intronic
1148778031 17:50106676-50106698 ACTGGAGCCTACAGAGGCATTGG + Intronic
1149277029 17:55053069-55053091 ACTGGATCCTCTACCGGAATGGG + Intronic
1159440402 18:68471564-68471586 GCTGGAGACTGGAGTGGAGTAGG - Intergenic
1160897256 19:1408497-1408519 CCCGGAGCCCCGAGTGGGATAGG - Intronic
1162933444 19:13968673-13968695 GCTTGAGCCTGGAGTAGAATGGG + Exonic
1162946400 19:14046521-14046543 ACTGGAGCATGTAGTGGACTGGG + Exonic
1166454869 19:42932478-42932500 AATGGAGTCACGAGTGAAATGGG + Intronic
928743242 2:34380749-34380771 ACTGCAGCCTCCAGTGGCACTGG - Intergenic
931320744 2:61172758-61172780 ACTGGAGGCTTGGGTGGAAAGGG + Intergenic
932452308 2:71819710-71819732 AATGGATCCTCAAGTGAAATTGG - Intergenic
934776149 2:96938784-96938806 ACTAAAGCCACGAGTGGAAAAGG + Intronic
936926851 2:117745733-117745755 ACTGGAGCAGGGAGTGGAAGAGG + Intergenic
936983585 2:118287332-118287354 ACTGGAGCCTGGTGTGGGAGGGG + Intergenic
942193026 2:173489847-173489869 AATGAAGCCTCCAATGGAATGGG - Intergenic
944900790 2:204213938-204213960 ACTTGAGCCTCTTGTGGAATAGG + Intergenic
946163547 2:217850089-217850111 CCTGGAGTCTTGAGTGGTATGGG - Intronic
948454808 2:238100027-238100049 ACAGGAGCCCCGAGTGGCCTGGG - Intergenic
1169701726 20:8454474-8454496 ACAGGAGCCCCTAGTGGAGTTGG + Intronic
1170089344 20:12573435-12573457 ATTGGAACCTCTGGTGGAATTGG - Intergenic
1170905821 20:20514585-20514607 GCTGGGGCATGGAGTGGAATGGG - Intronic
1171137849 20:22712962-22712984 ACTGGAGCCTGTAGTGGGGTGGG - Intergenic
1174436622 20:50511205-50511227 AGTGGGGCCTAGAGTCGAATAGG + Intronic
954902727 3:54033897-54033919 TCTGGAGCCTCAGGCGGAATCGG + Intergenic
955681465 3:61505905-61505927 ACTGAAGGCCCTAGTGGAATGGG + Intergenic
956836613 3:73100976-73100998 ACTGGCACCTTGAGGGGAATGGG - Intergenic
957159570 3:76592293-76592315 TCTTGAGCCTCCAGGGGAATTGG - Intronic
958603721 3:96331749-96331771 TCTGGAGACACGAGTGGAAAAGG + Intergenic
961637160 3:128340904-128340926 ACTGGAGCCTGGATTGGAGCAGG + Intronic
962340912 3:134582334-134582356 ACTGGGGCCTGTAGGGGAATGGG - Intergenic
963630928 3:147729124-147729146 ACTGGGGCCTCTTGTGGGATGGG + Intergenic
973198137 4:47468824-47468846 GCTGCAGCCTCCATTGGAATGGG + Intergenic
985713363 5:1442501-1442523 CCTGGAGCCTGGAGTGGCAGAGG - Intronic
985744440 5:1638203-1638225 ACTGGAGGCTCCAGTGGCTTTGG + Intergenic
985761767 5:1752627-1752649 ACTGGACCCTCCAGTGCCATGGG + Intergenic
990546187 5:56823750-56823772 CCTGGTGGCTCGAGTGAAATAGG + Intronic
993191891 5:84694244-84694266 ACTGGAGCCTGTTGTGGAGTGGG - Intergenic
998045933 5:138986656-138986678 GATGGAGCCTAGAATGGAATTGG - Intronic
998722699 5:144972831-144972853 ACTGGGGCCTGTTGTGGAATGGG - Intergenic
999743864 5:154576861-154576883 ACTGGAGCTTCCAGTGGGAGAGG + Intergenic
1003873050 6:10416747-10416769 TCTGCAGCCTTGGGTGGAATGGG - Intronic
1007321041 6:41028814-41028836 ACTGAAGCCTAGAGAGGAGTAGG - Intronic
1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG + Intergenic
1013389349 6:109667557-109667579 ACTGGAGCCTGTTGTGGGATGGG - Intronic
1016389100 6:143557450-143557472 ACTGGAGCTTTGGGTGGGATTGG + Intronic
1022114985 7:27253215-27253237 ACTGGAGCCTGGAGGGAGATGGG + Intergenic
1027653141 7:80896602-80896624 ACTGGAACCTCAGGTGGAATAGG + Intronic
1034349995 7:150409328-150409350 GCTGGAGCCTCGAGGGGCTTGGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035626953 8:1077514-1077536 AGTGGAGCCCAGAATGGAATTGG - Intergenic
1039828342 8:41193678-41193700 TCTGGAGCCCAGAGTGGCATGGG + Intergenic
1045923092 8:107555401-107555423 ACTGGGGCCTGTCGTGGAATGGG + Intergenic
1046792519 8:118336997-118337019 ACTGGGTCCTGTAGTGGAATGGG + Intronic
1057644528 9:96860257-96860279 CCTGGGGCCTTGAGTGAAATAGG + Intronic
1062145080 9:134984638-134984660 ACTGGAGCCCCAAGTAGAAGTGG + Intergenic
1062554812 9:137109126-137109148 ACGGGCCCCTCCAGTGGAATGGG + Exonic
1203384137 Un_KI270438v1:3773-3795 ATTGAAGCCTACAGTGGAATAGG + Intergenic
1187985000 X:24800635-24800657 ACTGGAGGTTGGAGTGGAAGAGG + Intronic
1192718545 X:73668711-73668733 AATGGAGCTTCCAGAGGAATAGG - Intronic
1197423459 X:126266697-126266719 ACTGGAGCCTGTTGTGGAGTGGG - Intergenic
1201969519 Y:19776208-19776230 ACTGAAGGCCCTAGTGGAATGGG - Intergenic