ID: 1117867433

View in Genome Browser
Species Human (GRCh38)
Location 14:60164773-60164795
Sequence GGAGTTTCCCTTACAAACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117867432_1117867433 -9 Left 1117867432 14:60164759-60164781 CCGGTACTTACAAAGGAGTTTCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 45
1117867430_1117867433 -1 Left 1117867430 14:60164751-60164773 CCGGGCTTCCGGTACTTACAAAG 0: 1
1: 0
2: 1
3: 0
4: 54
Right 1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117867433 Original CRISPR GGAGTTTCCCTTACAAACGC AGG Intronic
900132480 1:1093010-1093032 GGAGTTCCCCTTGCACAGGCTGG - Intronic
904835621 1:33333843-33333865 GAAGTTTCCCACACAAACTCAGG - Intronic
910089808 1:83449176-83449198 GGAAATTCCCTTCCAAAGGCAGG - Intergenic
924144621 1:241061111-241061133 GAAGTTTCCCCTAGAAAAGCTGG + Intronic
1065214507 10:23437724-23437746 TGGCTTTCCCTTACAAAGGCGGG + Intergenic
1074190496 10:111131090-111131112 AGAATTTCCTTTACAAAAGCCGG + Intergenic
1078535154 11:12167253-12167275 AGAGTTTTCATTACATACGCTGG - Intronic
1079135303 11:17773084-17773106 GGAGGGTCCCTTGCAAAGGCAGG + Intronic
1083794818 11:65009741-65009763 GAAGTTTCCCCTTCAAAAGCAGG + Intergenic
1097005159 12:55911436-55911458 GCAGTTTCCCCTACAAAGGTCGG + Intronic
1097795468 12:63857107-63857129 GGAGTTTCGCTTACCCAGGCTGG + Intronic
1098032696 12:66270923-66270945 GGAGTTTCCCTGACATACTCTGG - Intergenic
1105882810 13:24618420-24618442 GGTGTTTCCATTACACACACAGG + Intergenic
1108410456 13:50141229-50141251 GGACTTTCCCTTTTAAATGCTGG + Intronic
1112005843 13:95253078-95253100 GGTGTTTTCCTTAGAAACACAGG - Intronic
1112756867 13:102645416-102645438 GCAGCTCCCCTTACAAAAGCAGG + Intronic
1117741572 14:58824306-58824328 GGAGTTTCCCTAGGAAACCCTGG - Intergenic
1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG + Intronic
1120080446 14:80210542-80210564 GAGGCTTCCCTTACAAATGCTGG + Intronic
1122129685 14:99597820-99597842 GGAGATCCCCTGACACACGCTGG - Intronic
1126946495 15:53827515-53827537 GGAGTTTCCCTAAGAGACACTGG - Intergenic
1127800541 15:62473597-62473619 GAACCTTCCCTTACAAACACAGG - Intronic
1153676214 18:7458176-7458198 GGAGGTGCCTTTAGAAACGCAGG + Intergenic
1153811908 18:8759648-8759670 GGAGTTGCCCTTCCAAGCCCAGG + Intronic
1153874253 18:9352502-9352524 GGATTTTCCCTTACAAACTTGGG - Intronic
1156435457 18:37123100-37123122 GAAGTTTTCTTTACAAAGGCTGG - Intronic
1156564690 18:38174314-38174336 GAAATTTCCCTAACAAAAGCGGG + Intergenic
926127362 2:10279754-10279776 GGAGTTTAACTTACAAAGGGTGG - Intergenic
947395289 2:229680597-229680619 GGAATTTCCCTCACAAAAGCAGG + Intronic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
1182667437 22:31970210-31970232 GGTGTCTCCCTTCCAAACTCAGG - Intergenic
1183218405 22:36496159-36496181 GGAGTTCCCCATACAGATGCTGG - Exonic
955627255 3:60931593-60931615 GGAGTTTCGTTTACAAACAGGGG - Intronic
958780589 3:98537073-98537095 GGATTTTCCCCTGCAAATGCCGG + Intronic
959327540 3:104956644-104956666 CCAGTTTCCCTTGCAATCGCTGG + Intergenic
959648870 3:108732365-108732387 GGAATTCCCCTTACCAACGCTGG - Intergenic
963768693 3:149366236-149366258 GGAGTTTCCCTTAAAGACTGCGG + Intergenic
964647205 3:158970925-158970947 GGATTTTCCCTTAAAAATACAGG - Intronic
990288420 5:54324658-54324680 GAATTTTCTCTTACAAAAGCAGG - Intergenic
991336781 5:65557568-65557590 TGAGGTTCCCAGACAAACGCTGG + Intronic
998204912 5:140151381-140151403 GGAGTTTCCCCTACACACCACGG + Intergenic
1012961675 6:105628785-105628807 GGAGTTTCCATTACAGAGGCAGG + Intergenic
1022720870 7:32941118-32941140 GGAGATGCCCTTACAAAAGGAGG - Intergenic
1027306664 7:76905623-76905645 GGAAATTCCCTTCCAAAGGCAGG - Intergenic
1028590277 7:92485699-92485721 GGAGTAGCCCTTACAAACAGTGG + Intergenic
1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG + Exonic
1035602947 8:908218-908240 CCAGTTTCCCTTAAAAACCCAGG - Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1055922002 9:81470947-81470969 GGAGTGTCCTTTACATACACAGG - Intergenic
1189623061 X:42864453-42864475 GGAGGTTCTCTTACAAGAGCTGG - Intergenic
1197172144 X:123446085-123446107 GGAGTCTCCTTTACACACACTGG + Intronic