ID: 1117869206

View in Genome Browser
Species Human (GRCh38)
Location 14:60181672-60181694
Sequence ATGAATAATACTATGAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117869203_1117869206 20 Left 1117869203 14:60181629-60181651 CCATTCATCTGTCAATAGAAATT No data
Right 1117869206 14:60181672-60181694 ATGAATAATACTATGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117869206 Original CRISPR ATGAATAATACTATGAATAT TGG Intergenic
No off target data available for this crispr