ID: 1117872474

View in Genome Browser
Species Human (GRCh38)
Location 14:60215740-60215762
Sequence ATGGAGAATGTGAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117872474_1117872477 -5 Left 1117872474 14:60215740-60215762 CCAACCTCATTCACATTCTCCAT No data
Right 1117872477 14:60215758-60215780 TCCATCCATTGTGAGGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117872474 Original CRISPR ATGGAGAATGTGAATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr