ID: 1117875029

View in Genome Browser
Species Human (GRCh38)
Location 14:60243433-60243455
Sequence TTACATGCATTGTGTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117875029_1117875031 25 Left 1117875029 14:60243433-60243455 CCATGCAGACACAATGCATGTAA No data
Right 1117875031 14:60243481-60243503 TAAAATGTATTAACATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117875029 Original CRISPR TTACATGCATTGTGTCTGCA TGG (reversed) Intergenic
No off target data available for this crispr