ID: 1117875611

View in Genome Browser
Species Human (GRCh38)
Location 14:60248548-60248570
Sequence TGACCCCAGGAAGCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 2, 2: 5, 3: 37, 4: 353}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117875611_1117875617 -3 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875617 14:60248568-60248590 TCACTGGGAGAGGAAGGCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 291
1117875611_1117875629 28 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875629 14:60248599-60248621 GACTCTGGGGTAGGGGGGTCTGG 0: 1
1: 0
2: 2
3: 17
4: 374
1117875611_1117875628 23 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875628 14:60248594-60248616 AGTGGGACTCTGGGGTAGGGGGG 0: 1
1: 0
2: 4
3: 42
4: 358
1117875611_1117875623 15 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875623 14:60248586-60248608 TCTGGAGGAGTGGGACTCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1117875611_1117875618 0 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875618 14:60248571-60248593 CTGGGAGAGGAAGGCTCTGGAGG 0: 1
1: 0
2: 5
3: 53
4: 542
1117875611_1117875619 5 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875619 14:60248576-60248598 AGAGGAAGGCTCTGGAGGAGTGG 0: 1
1: 2
2: 7
3: 72
4: 684
1117875611_1117875620 6 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875620 14:60248577-60248599 GAGGAAGGCTCTGGAGGAGTGGG 0: 1
1: 0
2: 2
3: 52
4: 665
1117875611_1117875627 22 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875627 14:60248593-60248615 GAGTGGGACTCTGGGGTAGGGGG 0: 1
1: 0
2: 2
3: 30
4: 343
1117875611_1117875621 13 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875621 14:60248584-60248606 GCTCTGGAGGAGTGGGACTCTGG 0: 1
1: 0
2: 0
3: 25
4: 287
1117875611_1117875622 14 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875622 14:60248585-60248607 CTCTGGAGGAGTGGGACTCTGGG 0: 1
1: 0
2: 3
3: 22
4: 304
1117875611_1117875625 20 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875625 14:60248591-60248613 AGGAGTGGGACTCTGGGGTAGGG 0: 1
1: 1
2: 1
3: 29
4: 311
1117875611_1117875616 -9 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875616 14:60248562-60248584 CTGGGGTCACTGGGAGAGGAAGG 0: 1
1: 1
2: 2
3: 73
4: 601
1117875611_1117875624 19 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875624 14:60248590-60248612 GAGGAGTGGGACTCTGGGGTAGG 0: 1
1: 0
2: 1
3: 33
4: 461
1117875611_1117875626 21 Left 1117875611 14:60248548-60248570 CCTGCTTGGGCTTCCTGGGGTCA 0: 1
1: 2
2: 5
3: 37
4: 353
Right 1117875626 14:60248592-60248614 GGAGTGGGACTCTGGGGTAGGGG 0: 1
1: 0
2: 1
3: 27
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117875611 Original CRISPR TGACCCCAGGAAGCCCAAGC AGG (reversed) Intronic