ID: 1117875775

View in Genome Browser
Species Human (GRCh38)
Location 14:60249206-60249228
Sequence GCGCGGGGCCGCGCTAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117875775 Original CRISPR GCGCGGGGCCGCGCTAGAGG CGG Intronic
901730095 1:11273125-11273147 GGGCGGGGCCGAGCCAGAGGCGG - Intergenic
903555032 1:24187162-24187184 GCGCGGGGCCGCGGGAGGGAGGG - Intronic
904813785 1:33180975-33180997 GGGCGGGGCCGGGCTGGAGGTGG - Intronic
904837777 1:33349966-33349988 GGGCGGGGCCGCGGGAGGGGCGG + Intronic
905847146 1:41242312-41242334 GCGGGGCGGCGCGCTGGAGGAGG + Intergenic
906140567 1:43531467-43531489 GAGCGCGTCCGCGCTAGAAGGGG - Intronic
907909726 1:58815415-58815437 GCGCCGGGCCGCGGGGGAGGCGG + Intergenic
910257184 1:85259704-85259726 GGGCGGGGCCACGCGAGGGGCGG - Intergenic
910657426 1:89633045-89633067 GTGCGGGGCGGCGCTGGAGGCGG + Intergenic
914679315 1:149927851-149927873 GGGCGGGGCCGCGGAAGAGGAGG + Exonic
916535378 1:165698605-165698627 GGGCGGGGCCGCGGGAGGGGCGG + Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
924198854 1:241639763-241639785 GCGCGGGGCCGAGCGGGAAGCGG + Intronic
1065025063 10:21534015-21534037 GCGCGGGGGCGCGCACGCGGGGG - Intergenic
1068989241 10:63133723-63133745 GCCCGGGGCCCCGCGACAGGGGG - Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1071309341 10:84328450-84328472 GGGCGGGGCGGGGCCAGAGGTGG + Intergenic
1073292778 10:102421550-102421572 GCTGGGGGCTGGGCTAGAGGCGG - Intronic
1076991745 11:279317-279339 GCGCGGCCCCGTGCTGGAGGCGG - Exonic
1077121515 11:910964-910986 GGGCGGGGCCGCGCCGGGGGCGG + Intronic
1077464707 11:2728194-2728216 GCGAGTGGCCGCTCCAGAGGTGG - Intronic
1077500859 11:2909276-2909298 GGGCAGGGCCGGGCTGGAGGCGG - Exonic
1083437558 11:62653124-62653146 GCGCGGGGCCGCGCGATGGGGGG + Intronic
1083679826 11:64346136-64346158 GTGTGGGGCTGCGCTTGAGGAGG + Intronic
1087673282 11:101129840-101129862 GGGCGGGGCCTCCCTAGAGGAGG - Exonic
1090056857 11:123431079-123431101 GCGCGGGGACGCGCTGGGTGTGG - Exonic
1090204450 11:124876776-124876798 GGGCGGGGCCTGGCAAGAGGGGG + Intronic
1096699262 12:53371507-53371529 GCGGAGGGCCGGGCTGGAGGAGG - Intergenic
1096981222 12:55729033-55729055 GGGCGGGGCCGCGCGGCAGGCGG - Intronic
1100490413 12:95073159-95073181 GCGCGGGGCCCCGGGAGAGGCGG - Intronic
1102101460 12:110281583-110281605 GCTCGGGGCCGCGCGAGGGGCGG + Intronic
1103400592 12:120640733-120640755 GCCCGAGGACGCGCTGGAGGCGG - Exonic
1103521319 12:121538147-121538169 GCGCGGGGCCGCCAGGGAGGCGG + Intronic
1107851748 13:44577735-44577757 GCGCGGGCACGCGGCAGAGGAGG + Intergenic
1108350286 13:49585410-49585432 GCGCGGGGTCGAGCTCGCGGAGG - Intronic
1110860524 13:80341084-80341106 GCGCGCCGCAGCGCTAGCGGAGG - Intergenic
1112734480 13:102400961-102400983 GAGCGGGGCCGCGAGGGAGGGGG + Intronic
1117875775 14:60249206-60249228 GCGCGGGGCCGCGCTAGAGGCGG + Intronic
1118288993 14:64503761-64503783 GCGGGAAGCCGCGCGAGAGGCGG - Exonic
1125603657 15:40928467-40928489 GTGAGGGGACGCGCTGGAGGCGG + Intergenic
1129440648 15:75578841-75578863 GCGCGGGGACGCGGAAGCGGAGG - Exonic
1132991602 16:2798460-2798482 GCGCCAGGCCGCGGGAGAGGAGG + Intergenic
1140223120 16:73058206-73058228 GCGCGGGGCCGGGGAGGAGGGGG + Intronic
1140442633 16:74999287-74999309 GCGCGGGGAGGCGCCGGAGGAGG - Exonic
1143783153 17:9240005-9240027 GGGCGGGGCCGAGCGAGAGCGGG + Exonic
1144661881 17:17076243-17076265 GGGCAGGGCCCCGCTAGAGCTGG + Intronic
1145272616 17:21412801-21412823 GTGGGGGACGGCGCTAGAGGTGG + Intronic
1145310825 17:21700264-21700286 GTGGGGGACGGCGCTAGAGGTGG + Intronic
1147200607 17:38799225-38799247 GCGCGGGGCCGCGCTCAGAGGGG + Intronic
1151537777 17:74748569-74748591 GGGCGGGGCCGCGCTGAGGGTGG - Intergenic
1152257965 17:79251350-79251372 GGGAGGGGCAGCGGTAGAGGAGG - Intronic
1152320649 17:79607394-79607416 GGGCTGGGCTGGGCTAGAGGAGG + Intergenic
1152654407 17:81513165-81513187 GGGCGGGGCCGCGCCGGAGCTGG + Intronic
1152744143 17:82031479-82031501 GGCCGGGGTCGCGCTGGAGGCGG + Intergenic
1158930978 18:62325134-62325156 ACGCGGGGCCCCGCTCGGGGAGG - Intergenic
1159040669 18:63320356-63320378 GCGCGGGGCCGCGGCCGGGGAGG + Intergenic
1160025396 18:75211677-75211699 GCCCGGGGCCGCTCAGGAGGCGG - Intronic
1160577446 18:79864438-79864460 GGCCGGGGCCGGGCTGGAGGCGG + Intronic
1163435774 19:17294278-17294300 GCGCATGGCCGAGGTAGAGGCGG - Exonic
1165058906 19:33195283-33195305 GTGCGGGGCAGGGCTGGAGGAGG + Intronic
1165808690 19:38597271-38597293 GGGCGGGGCCAGGCCAGAGGAGG - Intronic
1166759021 19:45213079-45213101 GCCCGAGGTCGCGCTAGAGACGG + Exonic
1166932351 19:46308778-46308800 GCGTGGGGCCGGGCCAGAGGAGG + Intronic
1166991879 19:46697591-46697613 GGGCTGGGCCGTGCTGGAGGCGG - Intronic
1167251425 19:48400253-48400275 GGGCGGGGCCTCTCCAGAGGTGG + Intronic
1167268094 19:48493363-48493385 GGGCGGGGCCGAGCTAGAGTGGG - Intronic
1167379306 19:49129409-49129431 GCGCGTGGCAGTGCTCGAGGAGG + Exonic
1168110543 19:54189411-54189433 GCGCGGGGGCGCGCTGGGCGGGG - Exonic
927542852 2:23927751-23927773 GCAGGGGGCGGCGATAGAGGCGG - Intronic
927997279 2:27495001-27495023 GCGCGGGGCCGAGCTGCGGGCGG + Exonic
931649382 2:64454439-64454461 GCGCGGGTCCGAGCTGGCGGCGG - Exonic
932699752 2:73984789-73984811 GCCCCGGGCCGGGCGAGAGGGGG - Intergenic
935592753 2:104856290-104856312 GCGCGGGGACACGCCAGAGCTGG + Exonic
935971498 2:108534404-108534426 GCGCGGGGGCGCGGGAGGGGGGG - Intronic
937983096 2:127626388-127626410 GGGCGGGGCTGCGCTAGCTGTGG - Intronic
1170190286 20:13638739-13638761 GCCCCGGGCGGGGCTAGAGGAGG - Intronic
1175215876 20:57391527-57391549 GCGCGGGGCTGCGCTCATGGGGG - Exonic
1178673910 21:34614963-34614985 GCTCGGGGCCGCGGCGGAGGCGG - Exonic
1179436339 21:41364496-41364518 GGGCGGGGCAGCGCTGCAGGAGG + Intronic
1180666264 22:17515241-17515263 GTGCAGGGCCGTGCTGGAGGAGG + Intronic
1181283510 22:21736088-21736110 GCGCGGGGCGGGGCGAGAGCAGG + Intergenic
1181831614 22:25564799-25564821 GCGCCGGGCGGCGCGCGAGGGGG + Intergenic
1183590597 22:38777318-38777340 GCGGGGGCCGGCGCTGGAGGTGG - Intronic
1183929865 22:41229848-41229870 GGCCGGGGCCGGGCTAGAGGGGG - Intronic
953707608 3:45243165-45243187 GTGCTGGGCGGCCCTAGAGGGGG + Intergenic
953912112 3:46898475-46898497 GGGCGGGGCGGGGCGAGAGGCGG + Intronic
964570639 3:158105320-158105342 TCGCGGGGCCGGGCTGCAGGAGG - Intronic
966883314 3:184361744-184361766 GCGCGGGGCCTCCCGAGAGGCGG + Intronic
968434172 4:576365-576387 GCGCGGGGCCGCGGGCGGGGTGG - Intergenic
968452375 4:681606-681628 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452384 4:681626-681648 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452393 4:681646-681668 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452402 4:681666-681688 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452411 4:681686-681708 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452420 4:681706-681728 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968452429 4:681726-681748 GGGCGGGGCGGCGCTGGAGGGGG - Intronic
968803141 4:2756118-2756140 CCGCCTGGCCGCGCTGGAGGGGG - Exonic
968803280 4:2756520-2756542 GGGCGGGGCCGGGCTGTAGGCGG - Intergenic
975148239 4:70993503-70993525 GGGCGGGGCCGCGCGTGTGGCGG - Exonic
977064976 4:92303904-92303926 CAGCGGGGCCGGGCCAGAGGAGG - Intronic
977694308 4:99949829-99949851 GTGCGGGGACGCGCTCGCGGCGG - Intronic
981429866 4:144646058-144646080 GGGCGGGGGCGCGCGAGAAGCGG + Exonic
985549242 5:524705-524727 GCGCGGGGCAGCGGGACAGGCGG + Intergenic
987035159 5:14011846-14011868 GCGCCGCGCCGCGCTGGGGGCGG - Intergenic
991587528 5:68215692-68215714 GCGCGGGGCCGGGCCGGAGGCGG + Intergenic
992866296 5:80960448-80960470 TCGCGGGGCCGCGCTCCACGCGG + Intergenic
993727354 5:91383418-91383440 GCGCGGCGCGGCGCGGGAGGGGG - Intergenic
996745937 5:126845888-126845910 GGGCGGGGCGGCGGGAGAGGCGG - Intergenic
1007616354 6:43182019-43182041 GCGTGGGGGCGCGCTACCGGAGG - Intergenic
1010703132 6:79077115-79077137 GCGCGGGGGCGCGCGAGAGTCGG - Intronic
1012410127 6:98947643-98947665 GCGCGGGGCCGCGGGCGGGGAGG + Intronic
1013314654 6:108929935-108929957 GTGGGGGGCAGCGCTAGAGATGG - Intronic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1017002409 6:150005397-150005419 CCGCGGGGCCGAGGTGGAGGGGG - Intergenic
1017810707 6:157981734-157981756 GCGCGGGGCCGGGCGGGAGGCGG + Intergenic
1019712773 7:2525015-2525037 GGGCGGGGCCGCCCTGGAAGGGG + Intronic
1020756604 7:12211292-12211314 GCGCGCGGCCGCCGTAGAGCTGG - Exonic
1022723088 7:32957874-32957896 GCACGGGGCGGAGCTAGGGGAGG - Intronic
1036755158 8:11466675-11466697 GCGCGGACCCGCGCAGGAGGAGG - Exonic
1037529023 8:19756672-19756694 GCCCGGGACCGGGCTAGTGGGGG - Intronic
1038798210 8:30727782-30727804 GCGCGGGACCGAGCTGGCGGCGG - Exonic
1039212698 8:35235365-35235387 GGGCGGGGCCGCGGGAGGGGCGG - Intergenic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1042611748 8:70608020-70608042 GCCCGGGCCCGGGCTGGAGGTGG + Intronic
1046094310 8:109539669-109539691 GCTGGGGGCGGGGCTAGAGGAGG + Intergenic
1047262288 8:123274092-123274114 GCGCGGGGCCTGGCGGGAGGAGG - Intronic
1049164759 8:141119022-141119044 GCGAGGGGCCACCCTAGTGGTGG - Intronic
1049726242 8:144147819-144147841 GGGCGGGGCCGAGCGTGAGGCGG + Intergenic
1049799153 8:144509765-144509787 GCTGGGGGCCGCGCTAGCTGGGG + Exonic
1060514579 9:124257933-124257955 GCGCGGGCCCGCGCAGGCGGTGG + Intronic
1061680675 9:132241214-132241236 GGGCGGGGCCTCGCGAGACGGGG + Intronic
1062230606 9:135479813-135479835 GCGCGGGGCGGCGGCAGCGGCGG + Exonic
1062564303 9:137157106-137157128 GGGCGGGGCCGCTCTTGGGGAGG + Intronic
1192782056 X:74304312-74304334 GCTCGGGGATGCCCTAGAGGAGG + Exonic
1199942155 X:152637683-152637705 GGGCGGGGCCGGGCTGGGGGAGG - Intergenic