ID: 1117875896

View in Genome Browser
Species Human (GRCh38)
Location 14:60249629-60249651
Sequence CGCCGCCGCCTCGGCCGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 8, 3: 68, 4: 487}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117875875_1117875896 30 Left 1117875875 14:60249576-60249598 CCTCCCCCGGCTGCCGCCGTCGC 0: 1
1: 0
2: 7
3: 63
4: 605
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875887_1117875896 -5 Left 1117875887 14:60249611-60249633 CCCCTCCCCGGCTGCCGCCGCCG 0: 1
1: 2
2: 11
3: 139
4: 949
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875890_1117875896 -10 Left 1117875890 14:60249616-60249638 CCCCGGCTGCCGCCGCCGCCGCC 0: 4
1: 118
2: 1502
3: 2121
4: 4166
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875882_1117875896 14 Left 1117875882 14:60249592-60249614 CCGTCGCCGCCGCGGTGACCCCC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875885_1117875896 5 Left 1117875885 14:60249601-60249623 CCGCGGTGACCCCCTCCCCGGCT 0: 1
1: 0
2: 2
3: 29
4: 250
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875879_1117875896 24 Left 1117875879 14:60249582-60249604 CCGGCTGCCGCCGTCGCCGCCGC 0: 1
1: 32
2: 256
3: 496
4: 1299
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875876_1117875896 27 Left 1117875876 14:60249579-60249601 CCCCCGGCTGCCGCCGTCGCCGC 0: 1
1: 0
2: 18
3: 228
4: 871
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875883_1117875896 8 Left 1117875883 14:60249598-60249620 CCGCCGCGGTGACCCCCTCCCCG 0: 1
1: 1
2: 2
3: 34
4: 298
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875881_1117875896 17 Left 1117875881 14:60249589-60249611 CCGCCGTCGCCGCCGCGGTGACC 0: 1
1: 0
2: 3
3: 64
4: 456
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875877_1117875896 26 Left 1117875877 14:60249580-60249602 CCCCGGCTGCCGCCGTCGCCGCC 0: 1
1: 5
2: 144
3: 1594
4: 2497
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875888_1117875896 -6 Left 1117875888 14:60249612-60249634 CCCTCCCCGGCTGCCGCCGCCGC 0: 1
1: 1
2: 30
3: 173
4: 1267
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875889_1117875896 -7 Left 1117875889 14:60249613-60249635 CCTCCCCGGCTGCCGCCGCCGCC 0: 1
1: 7
2: 159
3: 1805
4: 3559
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875886_1117875896 -4 Left 1117875886 14:60249610-60249632 CCCCCTCCCCGGCTGCCGCCGCC 0: 1
1: 6
2: 42
3: 356
4: 2923
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487
1117875878_1117875896 25 Left 1117875878 14:60249581-60249603 CCCGGCTGCCGCCGTCGCCGCCG 0: 1
1: 4
2: 51
3: 347
4: 842
Right 1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG 0: 1
1: 0
2: 8
3: 68
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117875896 Original CRISPR CGCCGCCGCCTCGGCCGACC AGG Intronic
900092099 1:925029-925051 CAGCGCCCCCTCGGCCGAGCCGG - Intronic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
900651690 1:3732962-3732984 GGCCGCCGCCTGGGCCGCCGCGG - Exonic
900796576 1:4712034-4712056 GGTCGCCGCCCCGGCCGCCCCGG + Exonic
901045572 1:6393654-6393676 CGCGGCAGCCGCGCCCGACCCGG + Intronic
901489286 1:9588656-9588678 CGCCGCCGCCCCGCCCACCCGGG + Intergenic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
902586196 1:17439813-17439835 CGCCCCCGCCCCGCCCGGCCTGG + Intergenic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903777141 1:25800350-25800372 CGCCGCTGCCGCCGCCGTCCGGG + Exonic
903828644 1:26161951-26161973 CGCCGCCGCCCGCGCCGCCCGGG - Exonic
903998316 1:27322235-27322257 CGCCGCCGCCACCCCCGCCCAGG + Exonic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906365422 1:45205978-45206000 CGCCGGCGCCGGGGCCGCCCCGG + Exonic
906377023 1:45304032-45304054 GGCCTCCGCCTCTGCTGACCTGG + Intronic
906520896 1:46466453-46466475 CGCGGCCGCATCGCCCGGCCTGG - Intergenic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
908527581 1:65002685-65002707 CGCCTCCGCCGCCGCCGGCCAGG - Intergenic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
911219735 1:95234164-95234186 AGCCGCCGCCTCCACCGGCCAGG - Exonic
911664732 1:100539689-100539711 CGCCGCCGCCGCCGCCTTCCCGG + Exonic
913009890 1:114672106-114672128 CACCGCGGCCTCGGCCTCCCAGG - Intergenic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914197415 1:145454650-145454672 CGCCGCCGCCTCACCCGACTCGG + Intergenic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915355978 1:155255359-155255381 CGCCGCGGCCTCTCCCCACCAGG - Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
920850656 1:209625951-209625973 GGCCGCTGCCTCTGCCGCCCTGG - Exonic
922558193 1:226548927-226548949 CGCCGCCGCCGCCGCCGTCTCGG - Exonic
922625978 1:227043335-227043357 CGCTGCAGCCTCTGCCTACCAGG - Intronic
923119634 1:230978515-230978537 CCCCGCCGCCCCGGCCGACTCGG + Intronic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
923171638 1:231422210-231422232 CGCCGCCGCCTCAGCGTCCCGGG + Exonic
923372632 1:233328241-233328263 CGCCGCCGTGTCGGGCGACGAGG + Exonic
923429162 1:233904680-233904702 CGACGCCTCCCCGCCCGACCAGG + Intergenic
923490315 1:234478540-234478562 CGCCGCGTCCTCGGCAGGCCCGG + Exonic
924042603 1:239998050-239998072 CCCCGCGGCCACCGCCGACCCGG + Intergenic
924230478 1:241958227-241958249 CGCCGCCGCCTCGTCCTCGCTGG - Intergenic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065189811 10:23198905-23198927 CGCCGCCGCCTCAGCCTCCACGG - Intergenic
1065883829 10:30059516-30059538 CGCCGCCGCTCCGGCCGGCCGGG + Exonic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1067711752 10:48656048-48656070 CTCCCCTGCCTCGGCCGCCCGGG + Intronic
1070151982 10:73811067-73811089 CGCCGCTGCTCCGGCCGTCCCGG - Intronic
1070257678 10:74825688-74825710 CGCCGCTGCCTCCGGCCACCCGG - Intronic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1070800862 10:79243664-79243686 CGCCGCGGCCGCCGCCGGCCGGG + Intronic
1071086873 10:81875388-81875410 AGCCGCCGCCTCGGCCGAGGAGG + Exonic
1071618176 10:87094978-87095000 CGCCTCCGCCGCGGCCTCCCCGG + Intronic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1073064600 10:100750584-100750606 CTCCGCTGCCTCGGCCGGGCAGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074866417 10:117546667-117546689 CACCGCCGCCTCGGCTGTCCAGG - Intronic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1077072217 11:680532-680554 CGCTGCAGCCTCGGCCTCCCAGG - Intronic
1077204936 11:1337494-1337516 CGCCCCCGCCTCGGGCCCCCGGG - Intergenic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1081925749 11:46826820-46826842 CGCCGCCGCCGCCGCCTGCCGGG - Intronic
1082928902 11:58579230-58579252 CGCCTCCGCCTCCGCCGCCTAGG + Exonic
1083960342 11:66011861-66011883 CGCCGCCCCCTCGGCCTCCTGGG + Exonic
1083992974 11:66258011-66258033 CGCCCCCGCCCCGGGCCACCCGG - Intronic
1084297519 11:68222499-68222521 CGCCTCCGCCTCCGCCTCCCAGG - Intergenic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1088259263 11:107928824-107928846 CGCCGCCCCCTCAGCCCGCCCGG + Intronic
1089292163 11:117443928-117443950 CGCCGTCACCTCTGCCGGCCGGG - Exonic
1089432687 11:118436644-118436666 CGGGGCCGCCACCGCCGACCGGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1091386472 12:99182-99204 CGCCGACGCCTGCTCCGACCTGG + Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1092222545 12:6724712-6724734 CGCTGCCCCCTTGGCCGACTTGG - Exonic
1092518439 12:9240414-9240436 CGCAGCCGCCTCCGCCGCCGCGG - Intergenic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1094653429 12:32399389-32399411 CGCCGCCGCCTCCTCCGGCCGGG - Intergenic
1095261743 12:40105952-40105974 AGCCGCCGCCACGGCCGCTCCGG + Intronic
1096670944 12:53197922-53197944 CGCCTCCGCCTCTCCCGACGCGG + Exonic
1096749950 12:53752162-53752184 CGCCGCCGCCGCCGCCTTCCAGG + Intergenic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097155080 12:57006471-57006493 CGCCGCCTCCTCGTCGGGCCGGG - Intergenic
1099989765 12:89709325-89709347 CGCCGCCGCCGCTGCCGCCTTGG + Intergenic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1100565623 12:95790909-95790931 CGCCGCTGCCGCTGCCGCCCGGG + Intronic
1100869443 12:98894981-98895003 CGCCGCCGCCGCTGCCGCCAGGG - Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101910518 12:108857543-108857565 CGCCACCGCCACCGCCGCCCGGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1103800348 12:123533714-123533736 CGCCGCCGCCGCCGCCCACTCGG - Exonic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1104376237 12:128267281-128267303 CGCAGCGGGCCCGGCCGACCGGG + Intergenic
1104448841 12:128853532-128853554 CGGCCCCGCCGCCGCCGACCAGG - Exonic
1104568298 12:129903954-129903976 GGCCGCCGCCTCGGCCCGCCCGG + Intergenic
1105000646 12:132687830-132687852 CCGCGCCGCTGCGGCCGACCTGG - Intronic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1106157382 13:27171443-27171465 CGCCCCCGCCCGGGCCGCCCGGG + Intronic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106903022 13:34374672-34374694 CGCCGCCACCTCTGCCTCCCAGG - Intergenic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1107777247 13:43857825-43857847 CACTGCCGCCTCGGCCTCCCGGG - Intronic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110596592 13:77326794-77326816 CGCCGCCGCCTCGTCCCCGCGGG + Intronic
1111199961 13:84922606-84922628 CGCCCCCGCCCCGGCCCCCCCGG + Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112290907 13:98143401-98143423 CGCCGCGCCCTCGGCCGCCGGGG + Intronic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1113841702 13:113364474-113364496 CGCCGCGGCCTCGGAAGCCCCGG - Intergenic
1115203006 14:30874221-30874243 CGCCGCTGCCTCAGCAGCCCTGG + Intergenic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118776753 14:68978496-68978518 CGCCGCTTCCTGGGCCGCCCTGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1121279385 14:92688180-92688202 CGCCGCCGCCACCACCGTCCAGG - Exonic
1122072412 14:99213232-99213254 CCCCGGAGGCTCGGCCGACCTGG + Intronic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122542741 14:102507142-102507164 TGCCGCCGGCTCGGCCCGCCAGG - Exonic
1122546311 14:102524632-102524654 CGCCTCCGCCCCGGACCACCAGG + Intergenic
1122620966 14:103057479-103057501 CGCCGCCGCCGCCGCAGACTAGG + Intergenic
1122640484 14:103156470-103156492 CGCCGGCCCCTCAGCCCACCTGG - Intergenic
1122873731 14:104653348-104653370 CCCAGCCGCCTCGCCCGGCCTGG - Intergenic
1122873762 14:104653459-104653481 CCCAGCCGCCTCGCCCGGCCTGG - Intergenic
1122873773 14:104653496-104653518 CCCAGCCGCCTCGCCCGGCCTGG - Intergenic
1122873794 14:104653570-104653592 CCCAGCCGCCTCGCCCGGCCTGG - Intergenic
1122873815 14:104653644-104653666 CCCAGCCGCCTCGCCCGGCCTGG - Intergenic
1123004538 14:105314928-105314950 CGAGGCCGCCTCGGCCTCCCCGG + Exonic
1123023862 14:105414622-105414644 CGCCGCCGCCTCTGCCCACCAGG - Intronic
1123024883 14:105419872-105419894 CGCCGCCGCCGAGGCCGCCGAGG - Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124328120 15:28784250-28784272 CCCCGCAGCCTCGGCCTCCCAGG + Intergenic
1124574698 15:30897007-30897029 CGCCGCAGCCTCCGCCTCCCGGG - Intergenic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125516540 15:40324067-40324089 CGACGCGGCCCCGGCCGAGCGGG + Intergenic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125960668 15:43827037-43827059 CTCAGCCGCCGCGCCCGACCTGG - Exonic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1127953605 15:63833874-63833896 CGCCGCAGCCTCTGCGGAGCCGG - Exonic
1128743960 15:70100826-70100848 CGCCGCCTCCTCCGCAGAGCCGG + Intergenic
1129675980 15:77632641-77632663 CGCCGCCGCCTCTGCCGCTGGGG + Intronic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130305453 15:82709794-82709816 CGCCGCCGCCTTCGCCAGCCCGG - Intronic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1131735471 15:95326950-95326972 CGCAGCCGCCGCGGCCAATCCGG - Intergenic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132747676 16:1443734-1443756 CGCCGCCGCCTCCGCCTCCACGG - Intronic
1132779293 16:1614160-1614182 CTGCGCCGCCTCGGCCGGCCGGG - Intronic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1132915349 16:2340818-2340840 CCCGGCCGCCTCGGCCGCTCCGG + Intergenic
1133129643 16:3668910-3668932 CGCAGCCGCCTCGGCCCGCAGGG + Intronic
1133317833 16:4895074-4895096 CGCCCCCACCTCGGCTGCCCTGG - Intronic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1137617168 16:49855209-49855231 CCCCGCGTCCTCGGGCGACCAGG + Intronic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608643 16:85169437-85169459 CGCCGCCGCCGCGCCCAACTTGG - Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141972357 16:87492478-87492500 CCCGGCCGCCCCGGCCGCCCCGG - Intergenic
1143512891 17:7405623-7405645 CGCAGCCCCCTCCACCGACCCGG - Intronic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1143633397 17:8151295-8151317 CGCCGCCGCCACGGTCGCCAGGG + Intronic
1144021350 17:11241652-11241674 CGCCGCCGCCACAGCCGCCGCGG - Exonic
1144840625 17:18183738-18183760 CGCCGGCGCCTCTGCCGACCCGG + Intronic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1145979484 17:29003401-29003423 CTCCGCAGCCTCGGCATACCAGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146403668 17:32519457-32519479 CGCCGCCGCCAGAGCCCACCCGG - Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147258933 17:39197515-39197537 CGCCGCCGGCCCGGCCCAGCCGG + Exonic
1147620774 17:41865262-41865284 CGCCGCCGGCTCGGCAGGACTGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147971015 17:44219175-44219197 CGCCGCCCCCTCCGGCGGCCGGG + Intronic
1147971267 17:44219982-44220004 TCCCTCCGCCTCGGCCGCCCGGG - Intronic
1148021804 17:44558225-44558247 CGCCGCCGCCCGGGCCACCCGGG - Exonic
1148035448 17:44656487-44656509 CGCAGCCGCCTCCGCCGCCCGGG - Exonic
1148323254 17:46770001-46770023 CGCCATCGCCTCGGCCGGCGTGG - Exonic
1148664098 17:49361919-49361941 CGCCTCCGCCTCCGCCGCCCCGG + Intronic
1148786920 17:50150085-50150107 CGCCGCCGCACCCGCCGTCCCGG - Exonic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150373535 17:64661977-64661999 AGCCGGCGCCTCGGCCGCCACGG + Exonic
1150488790 17:65560928-65560950 CCCCGACGCCGCGGCCGGCCCGG - Intronic
1150562058 17:66302777-66302799 CCCCGCCGCCCCCGCCCACCCGG + Intronic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1151938877 17:77280964-77280986 CGCCGCCGCCTCGCCCGGCGGGG + Intronic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1152721913 17:81927539-81927561 CGCCCCGGCCTCGGCCCGCCGGG - Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153872653 18:9334855-9334877 CGCCCCGGGCTCGGCCGACCCGG + Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1156275819 18:35581802-35581824 CGCGACCGCCGCGGCCGGCCCGG + Intronic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157338156 18:46756478-46756500 CGCGGACCCCTCGGCCAACCGGG - Exonic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1157545134 18:48541123-48541145 CGCCGCTGCCTTCGCAGACCGGG + Intronic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160763565 19:797562-797584 CGCCGCCGCGCCGGCCTCCCCGG + Intronic
1160766971 19:813053-813075 CGACGCCGTCTCGGCCGCCTTGG + Exonic
1160790461 19:920584-920606 CCCCGCCGCCCCCGCCGGCCCGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1160991697 19:1862904-1862926 CGCCGCCGCGCCGGCCGGCAGGG - Intronic
1161027208 19:2042216-2042238 CGCCGCGGCCCCGCCCCACCCGG + Intronic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161241159 19:3224704-3224726 CGCCGCCGCCGCCGCCGGCTCGG + Exonic
1161277856 19:3428811-3428833 CCCCTCCGCCTCCCCCGACCGGG - Intronic
1161400673 19:4065397-4065419 CCCCGCCGCCTCGCCCGCGCGGG + Intronic
1161701338 19:5797622-5797644 CGCTGCAGCCTCTGCCAACCAGG + Intergenic
1162377873 19:10315883-10315905 CGCCACCCCCTCCCCCGACCCGG + Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162909844 19:13842830-13842852 CGCCTGAGCCTCGGCCGGCCCGG - Intergenic
1163158137 19:15449914-15449936 CGCCGCCGCCTCCACCGCTCGGG + Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1165510969 19:36266525-36266547 CACCGCCGCCACCGCCGCCCCGG + Intergenic
1165851391 19:38852053-38852075 CCCCGCCCCCGCGGCCGGCCCGG + Intronic
1166245420 19:41522215-41522237 CGCCGCCGCCGAGGCTTACCCGG - Intergenic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166806863 19:45492815-45492837 AGCCCCCGCCTCAGGCGACCTGG - Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167369593 19:49072646-49072668 CGGCCCCGCCTCGGCCGCCTCGG + Exonic
1167557473 19:50205306-50205328 CGCCGCCGCCGCCGCCCACCTGG + Intronic
1167696628 19:51019085-51019107 CTCCGCCGCCTCTGGCGCCCGGG - Exonic
1167738767 19:51311889-51311911 CGCCGCCGCCCTGGCCGGCTTGG + Exonic
1167748894 19:51368268-51368290 CGTGGCGGCCTCGGCCGACAAGG + Intronic
925725191 2:6865318-6865340 CGCCGCCGGCCTGGCCGCCCGGG + Exonic
926718115 2:15940674-15940696 CCCCGCCCCCCCGGCCCACCCGG + Exonic
927713819 2:25340915-25340937 CGCCGCCACCGCGGCCGCCCGGG + Intronic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928998664 2:37324580-37324602 CGCCGCCGCCTCAGCCCGACGGG + Intronic
932496584 2:72148624-72148646 CGCCGCCCCATCGCCCGCCCGGG - Intergenic
932827928 2:74958675-74958697 CGCCGCCGCCGCCGCCATCCCGG - Exonic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
934031903 2:88055744-88055766 CGCCGCCTCCGCCGCCGAGCAGG + Intergenic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935301539 2:101697657-101697679 CGCCTCCGCCTCCGCCTCCCGGG + Intronic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
937044984 2:118846532-118846554 CGCCGCCGCCACTGCCGCCGCGG + Exonic
937907028 2:127057454-127057476 CGCGGCGGCCGCGGCTGACCTGG + Exonic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
941020847 2:160407265-160407287 CGCCGCCGCCCGGGCCGGGCAGG - Intronic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942098546 2:172556174-172556196 CGGAGCCGCCTTGGCCGGCCCGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942278193 2:174337443-174337465 CGCCGCCGCTGCCGCCGCCCGGG - Exonic
942446158 2:176080283-176080305 CGCCGCCGCCACCGCCACCCCGG + Exonic
942450942 2:176107705-176107727 GGCCGCCTCCTCGGCCGCCGCGG - Exonic
942454660 2:176129782-176129804 CGCCGCCGAGGCTGCCGACCCGG - Exonic
942681348 2:178480624-178480646 CGCCGCCGCCGAGGCTTACCCGG + Exonic
943060504 2:183037958-183037980 CGCCTCCGCCGCGGCCTCCCCGG + Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945032955 2:205682311-205682333 CGTCGCCGCCCCGCCCGAGCTGG + Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946322247 2:218960852-218960874 CGCCGCCTCCTCGGCCGCCAGGG + Exonic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947363178 2:229366854-229366876 CGCCGCCCCCACAGCCAACCTGG + Exonic
948473720 2:238203410-238203432 GGGCGCCGCCTCAGCCGCCCCGG + Intronic
948869041 2:240789200-240789222 TGCCCCCGCCTCCCCCGACCCGG + Intronic
1168757255 20:325983-326005 CGCCCCCTCCTCGGCCGGCCCGG - Exonic
1169171823 20:3471340-3471362 CGCCGCGGCCTCGGCCTCACAGG - Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1169244506 20:4015282-4015304 TCCCGGCGCCTCGGCCGGCCGGG - Intronic
1169800338 20:9507089-9507111 CGCCGCCGCCTCCGCCGCCTGGG + Intergenic
1172005957 20:31819322-31819344 TGCCTCCGCCTCTGCCCACCCGG + Exonic
1172037308 20:32019118-32019140 CGCCGCCGCCTCCCCCGGCCCGG - Exonic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173548169 20:43914873-43914895 CGCCGCCGCCGCGCCCGCCATGG + Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174330408 20:49812964-49812986 CCCCGCCGCCTCCGCCGCCCGGG - Intronic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847033 20:62064850-62064872 CGCCCCCGCCCCGGCCGCCGGGG - Exonic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176546715 21:8205475-8205497 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1176554610 21:8249665-8249687 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1176565666 21:8388522-8388544 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1176573531 21:8432690-8432712 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1178992781 21:37368139-37368161 AGCCGCTGCCTCGGCGGCCCTGG + Intronic
1179613504 21:42567037-42567059 CACCGCCGTCTCCGCCGACCTGG + Exonic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179832475 21:44006039-44006061 CACTGCAACCTCGGCCGACCTGG + Intergenic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180101839 21:45591026-45591048 AGCCGCCGCCTCGCCCGCCGTGG - Intergenic
1180650525 22:17372590-17372612 CGCTGCCACCTCCGCCTACCGGG - Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181000843 22:19987156-19987178 CTCCGGCGCCTCGGCCGCTCGGG + Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181147392 22:20858686-20858708 CGCCTCCGCCTCCGCCTCCCCGG + Exonic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182226171 22:28800422-28800444 CGCCGGAGCCCCGGCCGGCCAGG - Exonic
1182586357 22:31346196-31346218 CGCCGCCGCCACCGCCCTCCAGG - Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183452841 22:37906198-37906220 CGCCGCCGCGTGGCCCGGCCCGG - Intronic
1183722544 22:39570994-39571016 CTCCGCAGCCTCGGCTGATCGGG + Intronic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185278706 22:49960888-49960910 CGCCGAAGCCGCGGCCGATCCGG - Exonic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185374371 22:50475234-50475256 CGCCGACACCACAGCCGACCCGG - Intergenic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203251580 22_KI270733v1_random:121741-121763 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1203259630 22_KI270733v1_random:166823-166845 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950583488 3:13878166-13878188 CGCCGGCGCCGCGGCCTCCCCGG - Intronic
950650220 3:14402552-14402574 CGCCCCCGGCCCGGCCGAGCTGG + Intergenic
950730088 3:14948580-14948602 CGGCCCCGCCCCCGCCGACCCGG - Intronic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
953657009 3:44862080-44862102 GGCCGCCGCCTCCGCCAAGCTGG + Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
958638546 3:96776894-96776916 CGCCGCCGGCTCCACCCACCCGG + Intergenic
960223741 3:115146934-115146956 GGCGGCTGCCTCGCCCGACCCGG - Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961389209 3:126542440-126542462 AGCCGCCGCCTCCCGCGACCTGG + Exonic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
962301893 3:134250658-134250680 CGCCGCCGCCGCCGCCGAAGAGG + Exonic
963116939 3:141738332-141738354 CGGCGCCGCCATGGCCGACGTGG + Exonic
963213952 3:142724290-142724312 CGCCGGCGCCCCGGCCGAGCCGG - Exonic
965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG + Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966449045 3:180037016-180037038 CGCCGCCGCAGCTGCCGAGCGGG + Intronic
967685281 3:192409913-192409935 CGCCGCCGCCTCCCCAGGCCCGG + Intronic
968493412 4:902523-902545 CACTGCCGCCTCGGCCGACTTGG - Intronic
968674931 4:1871931-1871953 GGCGGCCGCCTCGGCCGGGCCGG - Intronic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
969344723 4:6563614-6563636 CGCCGCGCCCGCCGCCGACCAGG - Intergenic
969912117 4:10456937-10456959 CACCCCCGCCTCGGTCGCCCCGG + Intronic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
975883607 4:78939397-78939419 CGCCAGCGCCGCGGCGGACCCGG + Exonic
977231141 4:94452249-94452271 CCCCGCAGCCCGGGCCGACCGGG + Intronic
978072539 4:104491322-104491344 CGCCGCCGCCACCGCCGGCGGGG + Exonic
979785647 4:124712702-124712724 CGCCGCCGCCGCCGCCGTCAGGG + Exonic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
982745817 4:159103423-159103445 CGCCGCCGCCTCTGCTGCTCGGG - Intergenic
985552025 5:538587-538609 CGATGCCGCCTCAGCCGCCCAGG + Intergenic
985629952 5:1009035-1009057 CGCCGCCGCCACGCCCCGCCGGG - Exonic
985717023 5:1468390-1468412 CTCCAGCTCCTCGGCCGACCTGG + Intronic
986402840 5:7396196-7396218 CCGCGCCGCCTCGGCCGGCCCGG - Exonic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
986858966 5:11904306-11904328 CGCCGCCGCCTCAGCCGCCGAGG + Intergenic
989103328 5:37839694-37839716 CGCCGCCGCCGCCGCCAACAGGG + Intergenic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
991587735 5:68216444-68216466 CACCGCCGCCTCGCCCGCCCCGG - Intronic
994083243 5:95731255-95731277 CTCCGCCCCCTCAGCGGACCGGG - Exonic
995106327 5:108381292-108381314 CGCCGCCGCCGCTGCCGCCTCGG - Exonic
997253608 5:132410622-132410644 CCGCGGCGCTTCGGCCGACCGGG - Intronic
997583985 5:135034051-135034073 TGCCGCCGCCTCTGCCCGCCCGG - Exonic
997899644 5:137753472-137753494 CCCGGCCGCCTCGGCCGCCCCGG + Exonic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
1001470206 5:172006551-172006573 CGCCGTCGCCTCCTCCGCCCGGG - Exonic
1002350026 5:178577092-178577114 CGCCGGGGCCTCGGCCCACAGGG - Intronic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004228864 6:13813827-13813849 CCCCGCCACCGCGGCCGAGCAGG + Intronic
1004561841 6:16760124-16760146 CGCCGCCGCCTCCTCCTACGTGG - Intronic
1004720490 6:18264329-18264351 CGCCCCTGCCGCGGCCGACGGGG - Intronic
1004924052 6:20402373-20402395 CGCCGCCGCTGCCGCCGCCCCGG + Exonic
1005040345 6:21595191-21595213 CGCCGCCGCCGCCGCCTGCCAGG - Exonic
1005886656 6:30102364-30102386 GGACGCAGCCTCGGCCCACCCGG - Intergenic
1006337423 6:33427963-33427985 CGCGGCCGTCCCGGCCGTCCCGG + Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1010569966 6:77464129-77464151 CGCCGCCGCCACCGCCACCCTGG + Intergenic
1013496716 6:110705114-110705136 CACCGCAGCCTCTGCCTACCAGG + Intronic
1013619324 6:111873023-111873045 CGGAGCCGCCTCGGCCGCGCCGG - Exonic
1015625936 6:135181191-135181213 CGCCGCCTCCGCGGTCGCCCTGG - Intergenic
1015935738 6:138404521-138404543 CGCCGCGTCCTCGGCCGCCCCGG - Exonic
1016010754 6:139135515-139135537 CGCCGCCGCCAGGGCCCCCCCGG - Exonic
1016340816 6:143060473-143060495 CCCCGCCCCCTCGCCCGGCCCGG + Intergenic
1016386860 6:143537368-143537390 TGCCGCCTCCTCGGCCGCCCGGG + Intronic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017842334 6:158232163-158232185 CACCGCCGCCGCCGCCGGCCCGG - Intergenic
1018156654 6:160991711-160991733 CGCCGCCACCGCCGCCGATCTGG + Intronic
1018331009 6:162727579-162727601 ACGCCCCGCCTCGGCCGACCAGG - Intronic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1020418283 7:7969689-7969711 GGCCGCAGCCCCGGCCGAGCAGG + Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021668643 7:23013552-23013574 TGCCGCCGCCTCGGCCCCACCGG - Intronic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025230962 7:57203183-57203205 CTCCTCCGCCTCGGCCCTCCTGG + Intergenic
1025614553 7:63106655-63106677 GGCCGCGGCCTTGGCCGACCAGG + Intergenic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1025777295 7:64570374-64570396 CGCCGCCGCCCTGGCCGGCTTGG - Intergenic
1027421154 7:78019488-78019510 CGCCGCTGCCGCCGCCGCCCGGG + Exonic
1029238696 7:99143673-99143695 CGGCGCCCCCTCGCCCGCCCCGG - Intronic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030176605 7:106660833-106660855 CGCCCCGGCCACGGCCGCCCGGG - Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034339396 7:150341908-150341930 TTCCGCAGCCTCGGCCGGCCCGG + Intergenic
1034446084 7:151115011-151115033 CGCCCGCGCCTCGGCCGCCGGGG + Intronic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034470511 7:151252032-151252054 CGCCGCCTCCCCGGCCGCCGCGG - Intronic
1034783798 7:153906524-153906546 CGCTGCAGCCTCGGCCTCCCAGG + Intronic
1034977736 7:155457978-155458000 CGCCGCCGCCTGGGCCGCCCGGG - Intergenic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041690085 8:60679355-60679377 CGCCCCCGCCGCCGCCGGCCCGG - Intronic
1042040214 8:64581378-64581400 CGCCGCCGCCCAGGCCCCCCGGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1045047574 8:98294086-98294108 GGACTCCGCCTCGGCCGCCCTGG - Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1045847838 8:106658204-106658226 CGCCTCCCGCGCGGCCGACCTGG + Intronic
1046103901 8:109644685-109644707 CGCCGCCGCTGCCGCCGTCCAGG + Exonic
1047382148 8:124373131-124373153 CACCGCCGCTTCGGCCGAGCAGG + Intergenic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048833454 8:138497353-138497375 CCCCGCCCGCTCGGCCGCCCGGG + Intergenic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049663076 8:143829126-143829148 CGCCCCCGCCTCACGCGACCCGG + Intronic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1049788442 8:144462382-144462404 CGCCGCCGCCTCGGCCGCCTCGG + Intronic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1050356980 9:4792855-4792877 CCCCGCCTCCCCGCCCGACCGGG - Exonic
1050437929 9:5629199-5629221 CGCCGCCGCCGCCGCCGACTCGG + Exonic
1051419000 9:16871565-16871587 CGTCCCAGCCGCGGCCGACCCGG + Intergenic
1051780527 9:20684221-20684243 CCCCGCCGCCTCGAACGCCCGGG - Intronic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1055611890 9:78031962-78031984 CGCCGCCGCCTCCTCCCTCCCGG - Intergenic
1055936833 9:81611792-81611814 CGCAGCCGCCGCGGCCGCCGTGG - Exonic
1056167844 9:83956309-83956331 CGCGGCCTCGTCGGCCGCCCTGG + Exonic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1058851214 9:109013502-109013524 CGCCGCCGCCTCGGGCGGGTGGG - Exonic
1059102396 9:111483513-111483535 GGCCGCCGCCTCCGCCTCCCAGG - Intronic
1059123267 9:111661506-111661528 CCCCGCCGCCCCAGCCCACCCGG - Exonic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1060087296 9:120714247-120714269 CGCCGTCGCCTCAGCCGCCTCGG - Exonic
1060700630 9:125747000-125747022 CGCCGCCGCCTCGGCCAGGCGGG - Intergenic
1061075846 9:128340888-128340910 CACCGCCACCTCGCCCGACTCGG - Intronic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061666419 9:132163009-132163031 CGCTGCCGCCTGTGGCGACCCGG - Intronic
1061953723 9:133950707-133950729 CGCCTGCGCCTCGGCCCTCCGGG + Intronic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062306022 9:135907484-135907506 CGCCGCCGCCGCCGCTCACCCGG - Intergenic
1062472425 9:136712404-136712426 CGCCCCCTCCTCAGCCGAGCCGG + Intergenic
1062574559 9:137200208-137200230 CGCCGCCGCCCGCGCCGCCCCGG - Exonic
1062574711 9:137200757-137200779 AGCCGCCGCCGCGGCCAGCCTGG + Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203467982 Un_GL000220v1:104892-104914 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1203475803 Un_GL000220v1:148864-148886 GGCCGCCGCCTCAGACGGCCAGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185877591 X:3713221-3713243 CGCGGCCGCCTGGGCCAGCCCGG + Exonic
1187831672 X:23388753-23388775 CGCTGCAGCCTCGGCCTCCCGGG - Intronic
1190285373 X:48957713-48957735 CGCCGCCTCCTCCGCCGCCGAGG - Intronic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1190758707 X:53422597-53422619 CGCCGGCGCCGCGGCCGTCATGG - Exonic
1190844919 X:54182854-54182876 CGCCGCCCCCTCAGCTGCCCGGG - Exonic
1192166267 X:68829367-68829389 CCCCGACGCCTCGACCGTCCCGG - Exonic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195370269 X:104166487-104166509 CGCCGCCGCCCGGCCCGGCCAGG - Intergenic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196965113 X:121047430-121047452 CGCCGCGGCCTCGCCGGGCCTGG - Intergenic
1197415276 X:126166008-126166030 CACCGCCGCCACGGCCAACACGG - Intergenic
1197763815 X:130046458-130046480 CGCCTCCGCCTCCGCCTCCCAGG + Intronic
1198534744 X:137574676-137574698 TGCCGCGGCCTCGGTCGAGCTGG + Intronic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1198807166 X:140504058-140504080 CGCCGCCGCCTCGGGCTACGGGG - Exonic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200787716 Y:7274323-7274345 CGCGGCCGCCTGGGCCGGCCCGG - Intergenic