ID: 1117879176

View in Genome Browser
Species Human (GRCh38)
Location 14:60292775-60292797
Sequence AAATATGAGCATTTTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117879176_1117879177 25 Left 1117879176 14:60292775-60292797 CCTTGTACAAAATGCTCATATTT 0: 1
1: 0
2: 1
3: 31
4: 306
Right 1117879177 14:60292823-60292845 TCAAAGTTACAAGAAATGTTTGG 0: 1
1: 0
2: 1
3: 35
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117879176 Original CRISPR AAATATGAGCATTTTGTACA AGG (reversed) Intronic
903434997 1:23343030-23343052 CAAAATGAGCATTTTGTATTTGG - Intronic
903523594 1:23974525-23974547 AAATATGATCATTTTGGGCCAGG + Intronic
905066220 1:35186106-35186128 AAACATAAGGATTTTGTATAAGG - Intronic
906894877 1:49759851-49759873 CAATATGAGAATTTTATACCTGG - Intronic
908574097 1:65440947-65440969 AAATAAATGCATTTTGTTCAGGG + Intronic
908635362 1:66157872-66157894 AAAGATGATCACTTTTTACATGG - Intronic
909666446 1:78139183-78139205 ATAAATGTGCATTTTATACAGGG - Intergenic
909846603 1:80401689-80401711 TGATATCAGCATTTTGTACCAGG - Intergenic
910290501 1:85595980-85596002 ACATATGAGCAATTTGTACATGG + Intergenic
911840318 1:102674631-102674653 GAATATGCTCATTTTGTAGATGG + Intergenic
914697144 1:150094939-150094961 ATAAATGTGCATTTTGTTCAAGG - Intronic
916278346 1:163020398-163020420 AATTAGGATCATTTTGTTCATGG + Intergenic
916423054 1:164654144-164654166 TAATATTTGCATTTTGTAGATGG + Intronic
916865240 1:168849399-168849421 CAATATAACCCTTTTGTACAAGG - Intergenic
917233921 1:172869899-172869921 AAATATAAACATTTTATATATGG - Intergenic
918428949 1:184438511-184438533 CAAGATGATCATTTTCTACATGG - Intronic
918501663 1:185202490-185202512 AAATATGAGCTTTGGGTACTAGG - Intronic
918775639 1:188626561-188626583 CAATATGATTGTTTTGTACATGG - Intergenic
919308049 1:195869622-195869644 AAATATATGCATTTTGCAAAAGG - Intergenic
921442883 1:215208744-215208766 AAATATGATGATTTTTTTCAAGG + Intronic
922580540 1:226694647-226694669 CAATATGAACATTTTGAACTGGG + Intronic
924014257 1:239702929-239702951 AAATATTATCAATTTGCACATGG - Intronic
924484165 1:244463837-244463859 AAATATGAGGATTCTCTACATGG - Intronic
1062782819 10:231746-231768 AAATTTGAACATCTTGAACAAGG - Intronic
1063507422 10:6613563-6613585 AAATATGAACATTTTGTAATGGG + Intergenic
1064831136 10:19467721-19467743 ACATACTAGCATTTTGTAAAGGG - Intronic
1065290842 10:24227831-24227853 CAATATGAGCATTTGAAACAGGG + Intronic
1066589406 10:36977399-36977421 AAAAATGACAATTTTGTAGATGG + Intergenic
1068016414 10:51522221-51522243 AAACATGATCATATTCTACATGG - Intronic
1070353503 10:75616175-75616197 AAATCTGATGATTTTGTAAATGG - Intronic
1071261726 10:83925767-83925789 AAATATGACCATTGTGTTCTAGG - Intergenic
1071313780 10:84371263-84371285 AAATATCAGCTTTGTGCACAAGG + Exonic
1071665811 10:87557277-87557299 AAATCTGAGAATGTAGTACATGG - Intergenic
1072760672 10:98053919-98053941 GAATCTGAGCATTCTGTAAAGGG - Intergenic
1072911144 10:99502411-99502433 AAATGGTAGCATTTTATACAAGG - Intergenic
1072944862 10:99800608-99800630 AAATATGAGCATTGATTCCAAGG + Intronic
1073450968 10:103608761-103608783 AATAATGAGCATTTTGTGCTGGG - Intronic
1073878806 10:107955614-107955636 AAATATCACCATTTTATATAAGG - Intergenic
1074599888 10:114903220-114903242 AAATGTTAGCATTTATTACATGG - Intergenic
1074796768 10:116954162-116954184 AAGAATCAGCATGTTGTACATGG - Exonic
1074958157 10:118412778-118412800 AGATTTGTGCATTTTGAACATGG + Intergenic
1075796212 10:125121507-125121529 AAAAGTGAGTAGTTTGTACATGG - Intronic
1076039592 10:127233128-127233150 AAATATTTGAATTTTGTTCAAGG + Intronic
1076560561 10:131360548-131360570 AAACAAGAGTATTTTCTACAAGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077798307 11:5514225-5514247 AAACATGAGCATTTTGAGCATGG - Intronic
1078048229 11:7937963-7937985 ACATATGAGCATATGGAACAAGG + Intergenic
1078486166 11:11725361-11725383 AAATGTTAGCATTTTTGACAGGG - Intergenic
1079180366 11:18188330-18188352 AAATATGAGTATTTTGGGGAAGG - Intronic
1081605175 11:44522796-44522818 GAGTATGAGTATTTGGTACAAGG + Intergenic
1081956129 11:47095640-47095662 AGATATGGGAATTTTGTATATGG - Intronic
1085364062 11:75921509-75921531 AAATATGAACTTTTTGTATAAGG - Intronic
1085901985 11:80711251-80711273 AAATATCAGCATTGCTTACATGG + Intergenic
1086233977 11:84605117-84605139 AATTATAAGCATTTTGTTCAAGG + Intronic
1086798097 11:91134152-91134174 AAATGTTAGCATTTTTTAAATGG - Intergenic
1087686173 11:101267645-101267667 AAATATTAGAATGCTGTACAAGG - Intergenic
1088674577 11:112180082-112180104 AAATAAAAGCATTTTATATAAGG - Intronic
1092988204 12:13867512-13867534 AAATATGTGCTTTTGTTACATGG - Intronic
1094426752 12:30324114-30324136 AACCATGAGCATTTTTTCCAGGG - Intergenic
1094655927 12:32419476-32419498 AAATCTGTGCATTTAGTAGAGGG - Intronic
1095045997 12:37506411-37506433 AGATCTGATGATTTTGTACAGGG + Intergenic
1095332345 12:40982010-40982032 AAATATAGGCATTTTGGAAATGG - Intronic
1096038101 12:48490683-48490705 AAATATGGGCTTCTTGGACATGG - Intronic
1097586472 12:61521926-61521948 AAATACAAACATTTTATACATGG - Intergenic
1097931009 12:65186480-65186502 AAATATTAGAATTTTTTAAAAGG - Intronic
1098070717 12:66671431-66671453 AAATCTGAGCATTTTTTAAAAGG - Intronic
1098724252 12:73942319-73942341 AAATATCAGTTTTCTGTACAGGG + Intergenic
1099095255 12:78367832-78367854 TCATTTGAGCATTTTCTACAGGG + Intergenic
1099386221 12:82016993-82017015 AAATCTGATGACTTTGTACAGGG + Intergenic
1099921539 12:88963245-88963267 AAAAATTAGCATTTTCTAGAAGG - Intergenic
1099986907 12:89676895-89676917 AAAAGTGAGCCTTTTCTACACGG + Intronic
1100651664 12:96596555-96596577 AAATCTGGACTTTTTGTACATGG - Intronic
1101059567 12:100957117-100957139 AAATATTATCATTTAGTTCATGG + Intronic
1101179209 12:102192856-102192878 AAAAAAGAGATTTTTGTACAGGG + Intronic
1106451285 13:29885131-29885153 AAATATGAGCCTTTTGGGGAAGG - Intergenic
1106933829 13:34696378-34696400 AAATATGAGTATGTTAAACAAGG - Intergenic
1108504960 13:51104387-51104409 AAAGAAAAGCATTTAGTACATGG + Intergenic
1108962511 13:56252898-56252920 AAATATAAGATTTTTGTAAAAGG - Intergenic
1110024472 13:70517805-70517827 AAATATGAGAACTTTGTAATAGG + Intergenic
1110766818 13:79289518-79289540 ACATATTAGCATATTGCACAAGG - Intergenic
1111477124 13:88763990-88764012 AAATATGAGGTTTTTGAATATGG + Intergenic
1112099036 13:96166899-96166921 AAATCTGATCATTTTTTAAAGGG + Intronic
1116513221 14:45772306-45772328 AAATAGGAGCCTTGTTTACATGG - Intergenic
1117569649 14:57034139-57034161 AAACATTAGCATATAGTACATGG - Intergenic
1117879176 14:60292775-60292797 AAATATGAGCATTTTGTACAAGG - Intronic
1118517950 14:66547171-66547193 AAATCTTAGCTTTTTGTAGATGG + Intronic
1119059586 14:71461372-71461394 CACTATGATCATTTTGTTCATGG + Intronic
1119220463 14:72902188-72902210 AAATATGTGTCTGTTGTACATGG - Intergenic
1120670934 14:87361589-87361611 AAATGTGACGATTTTGTAGAAGG - Intergenic
1120701193 14:87700835-87700857 AAAGATTATCATTTTGTACAGGG - Intergenic
1121771703 14:96549854-96549876 AAATATAAACATTTTGGACCCGG + Intronic
1122747394 14:103906763-103906785 AAATTTGAGCATTTGGTATTTGG - Intergenic
1122988344 14:105223770-105223792 AAATATGAGCAGTTTTCATACGG + Intronic
1124800197 15:32825130-32825152 AAAAATGAGCATCTTGGACCAGG - Intronic
1125100819 15:35910633-35910655 AAATATGAACATATTTTATATGG + Intergenic
1125438514 15:39674490-39674512 AGATATCAGCATTTCTTACAAGG + Intronic
1126858646 15:52862718-52862740 AGATCAGAACATTTTGTACATGG + Intergenic
1126900262 15:53307674-53307696 AAAAATGAGAATTTTGCCCAAGG + Intergenic
1126924722 15:53571248-53571270 AAATATGCATATTTTTTACATGG - Intronic
1127006416 15:54575576-54575598 AAAAATGAGCTTTTTGGCCAAGG + Intronic
1127898474 15:63323223-63323245 AAATCTGAGCTATTTGTTCAAGG + Exonic
1128333577 15:66771835-66771857 AAAAATGAGTATTTTGTAGATGG - Intronic
1131287402 15:91072482-91072504 AAACATGGGCATTTTATAAATGG - Intergenic
1131365584 15:91836711-91836733 AAATATGATGAGTTTGTAAAAGG - Intergenic
1131714398 15:95092424-95092446 AGCTGTGAGCATTTTGTACGTGG + Intergenic
1134842485 16:17412918-17412940 AGATACGAGCATTGTGAACATGG - Intronic
1134900280 16:17932060-17932082 CTATCTGAGCATTTTGCACAAGG + Intergenic
1136605131 16:31328659-31328681 ATATATGTGCATTGTGTGCATGG + Intronic
1136872558 16:33820868-33820890 TACTATCAGCATTTTGTTCAAGG + Intergenic
1137002888 16:35246652-35246674 AAATAGGAGACTTTTATACAGGG - Intergenic
1137315418 16:47315490-47315512 TAATATGAGCATTTTGTCATTGG - Intronic
1137374852 16:47943956-47943978 AAATATGATCAGTGTGTGCAGGG + Intergenic
1137933986 16:52616322-52616344 AAAGATTACCATTTTGTAAATGG + Intergenic
1137980635 16:53066418-53066440 AAAAATGTACATTATGTACATGG + Intronic
1138751625 16:59429713-59429735 AAGTATGAGCATTAAGTACGTGG - Intergenic
1141860818 16:86714874-86714896 AAATATGGTCTTTTTATACAAGG - Intergenic
1203099614 16_KI270728v1_random:1295200-1295222 TACTATCAGCATTTTGTTCAAGG - Intergenic
1143407948 17:6690532-6690554 AAATTTGAGCACTTGGTCCATGG + Intronic
1143518012 17:7429702-7429724 AAAGATGAGCAAGTTGGACACGG + Intergenic
1144006544 17:11105546-11105568 AAATATCAGCAATGAGTACATGG - Intergenic
1149264535 17:54913275-54913297 GAAAATGAGCATTTTGCCCATGG + Intronic
1150163837 17:62922590-62922612 AAATACTAGGATTTTGTACCTGG - Intergenic
1152431976 17:80253400-80253422 AAATGGGATCATTTTATACATGG + Exonic
1153126176 18:1793371-1793393 AAATATGACCATTATATACACGG - Intergenic
1155252251 18:23963778-23963800 AAATATTAGCTTTTTGCACAAGG - Intergenic
1156168262 18:34450244-34450266 AAAAAAGAGGATTTTGGACATGG + Intergenic
1156232510 18:35167677-35167699 AAATATAGGCATTGTGTACTTGG + Intergenic
1156635840 18:39028661-39028683 ACATATGAGCATTTTCAAAAGGG + Intergenic
1156868598 18:41916782-41916804 AAATATGGTAATTTTGTACAAGG - Intergenic
1157228324 18:45888818-45888840 AAATATGAACATTTTTAATAAGG - Intronic
1158108928 18:53918272-53918294 AAAGATGAACATTATGTACTAGG + Intergenic
1158902132 18:61973811-61973833 AAATATGGCCATTTTGTCCCTGG + Intergenic
1159242369 18:65758825-65758847 GAAAATGAGCATTATGTAAATGG + Intronic
1159257647 18:65968105-65968127 ACATATGAGAATTTAGGACAAGG - Intergenic
1159408530 18:68037979-68038001 AAATGTGAGTATATTGTAAATGG - Intergenic
1159635219 18:70797213-70797235 ACATTTGAGCAGTTTGTAGAGGG + Intergenic
1159784710 18:72699012-72699034 AAATATGAGAACTTTGTATTGGG - Intergenic
1159804239 18:72936454-72936476 AAATATCACCATTTTCTTCATGG - Intergenic
1160489510 18:79325433-79325455 AAATATGAGAAATTTGTAAAAGG + Intronic
1162615184 19:11794039-11794061 AAATATGTGGATTTTGTTCTAGG + Intergenic
1164140499 19:22457445-22457467 AAACATGAGCATTATGAAAAAGG - Intronic
1164311390 19:24049360-24049382 AAATATGACCAGATTGTGCATGG - Intronic
1164403517 19:27920634-27920656 AGAAATAAGCAATTTGTACAAGG - Intergenic
1164645076 19:29853251-29853273 AGATTTGTGCATTTTATACATGG + Intergenic
1168539217 19:57196585-57196607 CACTATGACCATTTTGTTCATGG + Intronic
926533245 2:14078662-14078684 AAATATGTGGCTTTTGTACTGGG + Intergenic
927340395 2:21977495-21977517 AAACATCAGCATTTTGAACTAGG + Intergenic
927743754 2:25596278-25596300 AAATATCAGCTTTTTATAAATGG + Intronic
930474757 2:51867845-51867867 AAATAAGAGCATTCCGTAAATGG + Intergenic
931124266 2:59256394-59256416 AAACTTGAGCATTTTATTCATGG - Intergenic
931428696 2:62193420-62193442 AAATAAGGGCATTTTCTCCATGG - Intergenic
931856047 2:66302639-66302661 AAATATCAGAATTTTATTCAAGG + Intergenic
932248260 2:70216596-70216618 TAATATAAGCATTTTGATCAAGG - Intronic
932869389 2:75381681-75381703 AAATATAAGCATTTCATACAAGG + Intergenic
932883383 2:75525029-75525051 ATATATATGCATTTTGTATATGG - Intronic
933307582 2:80620799-80620821 AAATATGAGCATTTCTTACCTGG - Intronic
933569776 2:83995938-83995960 AAAGAAGTGAATTTTGTACAAGG + Intergenic
934143246 2:89068877-89068899 AAATATGTCCAGTTTTTACAGGG - Intergenic
934225996 2:90131678-90131700 AAATATGACCAGTTTTTATAGGG + Intergenic
935814999 2:106839065-106839087 AAACAAGAGCATTTTGAACAGGG + Intronic
936226928 2:110663378-110663400 ATATATGAAAATTTAGTACATGG + Intronic
936895778 2:117425990-117426012 AAATATGATATTCTTGTACAAGG + Intergenic
939278251 2:140029669-140029691 AAAGATGAAAATTATGTACAGGG - Intergenic
939525086 2:143283138-143283160 AAATTTGATCATTTTGGACAGGG - Intronic
939527196 2:143311113-143311135 AAATATGAATCTTTTGTATAAGG - Intronic
939650075 2:144748759-144748781 AAATATCAACATTTTCTATAGGG + Intergenic
939660172 2:144879412-144879434 AAATATTAACATTTTATTCATGG - Intergenic
939686178 2:145203668-145203690 AAATAGGTGCATTCTGTAAAGGG + Intergenic
940261822 2:151788766-151788788 AAATAGCAGCATTCTTTACATGG + Intergenic
941468310 2:165855903-165855925 AAATTTCAGTATTTTGTTCAGGG - Intergenic
943482095 2:188431704-188431726 AAGTATGAGCATGTTGTAAATGG - Intronic
943716593 2:191159550-191159572 AACTGTGAGCATTCTGTACTGGG + Intergenic
944169535 2:196759643-196759665 ATATATGAGCATTTTTTTCTTGG + Intronic
945263296 2:207864888-207864910 AAATGTGAGTAGCTTGTACAAGG - Intronic
945288065 2:208102165-208102187 AAATAAAAGCATTTTCTAAATGG + Intergenic
945647794 2:212522100-212522122 AAATATCAACATTTTATATATGG - Intronic
946451163 2:219780709-219780731 AAATGTGAGCATTTTACACTTGG - Intergenic
946723026 2:222631498-222631520 AAATATGTGCATTTTGTAGGTGG - Intronic
1168888272 20:1275532-1275554 AAATTTAAGCAATTTGTCCATGG + Intronic
1172054050 20:32141842-32141864 AAAGATGTGCAGTTTGAACACGG + Exonic
1172803270 20:37593287-37593309 GCAGTTGAGCATTTTGTACAAGG + Intergenic
1172863149 20:38072823-38072845 AGATATGAGTATTTTGTGTATGG + Intronic
1174040474 20:47695957-47695979 AAAGAAGAGCATTTTTCACATGG - Intronic
1176263617 20:64197060-64197082 AAATGTGAGCCATTTGTCCATGG + Intronic
1177109061 21:17001813-17001835 AAATATCATCATTTTCTAGATGG + Intergenic
1177399186 21:20580176-20580198 AAATATGAATATTATGTTCATGG - Intergenic
1177524935 21:22278747-22278769 AAATATGAGCACTTTTTAAAGGG - Intergenic
1178865571 21:36324233-36324255 AAGAATGAACATTTTGTCCAGGG - Intronic
1183816604 22:40307122-40307144 AAATAGCAACATTTTGAACATGG + Intronic
949476463 3:4450970-4450992 AAAACAGAGCATTTTGTCCAAGG + Intronic
949623471 3:5842900-5842922 TAAAAAGAGGATTTTGTACATGG + Intergenic
950811930 3:15657519-15657541 GAACATAAGCAGTTTGTACATGG + Intergenic
952586381 3:34897827-34897849 AAATCTGAGAATTTTGTATGTGG - Intergenic
953990013 3:47476427-47476449 GAACATGAGCATCTTGTGCAGGG - Intronic
955503723 3:59610319-59610341 AAAGACTAGCATTTTCTACAGGG + Intergenic
956541673 3:70347291-70347313 AAATATATGCATTGTGTGCAAGG + Intergenic
956949820 3:74269419-74269441 TAATAATAGCATTTTGAACATGG - Intronic
956968400 3:74491139-74491161 AAATATGAGTATTTTGCATTGGG - Intronic
957639910 3:82838914-82838936 AAATATATGTATTTTGTAAATGG + Intergenic
957931484 3:86883715-86883737 AAATATGAGCATTTTAGCCACGG - Intergenic
957937359 3:86962158-86962180 AAAGATGAGCATTTTTCACGTGG + Intronic
959175659 3:102906261-102906283 AAATACAAGCATTTTGCATATGG + Intergenic
959212452 3:103404428-103404450 ATATATGAGCATTTTAGTCATGG - Intergenic
960420435 3:117438659-117438681 AAATATGACCATCTTGTCCATGG - Intergenic
960570740 3:119182967-119182989 AAATATGAGCATCGTGTCCAGGG + Intronic
961092743 3:124129078-124129100 AAATATGAGCATGCTGAATACGG - Intronic
961675441 3:128562401-128562423 AAAATTGAGCACTTGGTACAGGG - Intergenic
961960037 3:130845313-130845335 AAAGATGAGCAGGTTGTACTTGG + Intergenic
963624744 3:147657123-147657145 ACATCTTAGCATTTAGTACATGG + Intergenic
964280551 3:155059914-155059936 CAATATGAGAATTCGGTACAAGG + Intronic
966559568 3:181304908-181304930 CACTATGAGCATCTTTTACAAGG - Intergenic
970249085 4:14094918-14094940 AATTATGAACATTTTGAACATGG - Intergenic
970732016 4:19116562-19116584 AAATATGAGCCTTGTCTTCAAGG - Intergenic
970948909 4:21729120-21729142 AAATCTGAGCACCTTCTACAGGG + Intronic
971466104 4:26963168-26963190 AAATATAAGTATTTTATAAAAGG + Intronic
972827467 4:42776793-42776815 AAAAATGAGCACTTTTTACATGG - Intergenic
972969363 4:44553547-44553569 AAATAATAGCATTTTGTTTATGG + Intergenic
976003032 4:80394735-80394757 AAATATGTGCATTTTTTTCTGGG + Intronic
976302434 4:83528060-83528082 AAATGTGAACATTTTCTCCATGG - Intergenic
976348977 4:84038769-84038791 AAATATGAATATTTATTACAGGG + Intergenic
976385139 4:84448311-84448333 AAGTATGAATATTTTGTTCAGGG - Intergenic
976804899 4:89035773-89035795 AAAAATAAGCATGTTTTACATGG - Intronic
978099881 4:104825626-104825648 AAATATGACCATTGGGTACTAGG - Intergenic
978235025 4:106447443-106447465 TACTATCAGCATTTTGTTCATGG + Intergenic
979181613 4:117735837-117735859 AAAAATGAGCATTATGTTAAGGG + Intergenic
979574579 4:122273312-122273334 AAATTTGAGGATTATGTACTTGG + Intronic
980165271 4:129218743-129218765 AAATAAAAGCAGTTTGTTCAAGG - Intergenic
981158603 4:141470538-141470560 AAATATGAACATTTTGTGGAAGG - Intergenic
981706297 4:147662837-147662859 AAATTTAAACATTTTGTAAAAGG + Intronic
983663688 4:170158224-170158246 AAATTAGATCATTTTATACATGG + Intergenic
983751595 4:171279771-171279793 TAATTTAAGCATTTTGTACAAGG + Intergenic
984960963 4:185098269-185098291 AAATATTAGCATTTTAAATAAGG + Intergenic
985165137 4:187085125-187085147 AAATGTGATCATTTAGTAGAAGG + Intergenic
986881818 5:12183323-12183345 AAAGATGAGCATTTTGAAAAGGG + Intergenic
987937397 5:24483916-24483938 ACATATAATTATTTTGTACAAGG - Intergenic
989260220 5:39411189-39411211 AAATATGAGTATTTCATAAAGGG - Intronic
989726528 5:44593768-44593790 AAATAAGAACATTCTGTATATGG + Intergenic
990883105 5:60562201-60562223 AAATCTGAGCATTTTATAGAAGG + Intergenic
990967662 5:61466554-61466576 AAATATGCGCCCTGTGTACAAGG - Intronic
991255802 5:64612783-64612805 AAAGTTGAGCATTTTGTATTTGG - Intergenic
991383110 5:66053430-66053452 AAATATCTCCATTTTGTAAAAGG - Exonic
991512130 5:67390652-67390674 AACTATGAGCTTGTTGTATACGG + Intergenic
993547037 5:89225167-89225189 ATATATGAGTATTTTATAAACGG + Intergenic
994056320 5:95420700-95420722 ACATATGGGGATTTCGTACATGG - Intronic
994906340 5:105844632-105844654 AAATCCAAGCATTTTGTAGATGG + Intergenic
994985159 5:106923956-106923978 CAAAAAGAGCATTTTGTACAGGG - Intergenic
995440585 5:112187921-112187943 AAAGATAAGCAGTTTGTCCAAGG - Intronic
995448818 5:112277760-112277782 AGAAATGAACATTTTGGACAAGG + Intronic
996415683 5:123207825-123207847 TAATCTGAGTATTTTATACAAGG - Intergenic
998665120 5:144288265-144288287 AAATTTAAGCAATTTGTTCAAGG - Intronic
999820063 5:155218049-155218071 GAATATGAACATGTTCTACAAGG + Intergenic
999987986 5:157022876-157022898 GAATGTGAGCATGGTGTACATGG - Intergenic
1000701432 5:164456107-164456129 AAATGTAAGCAGTTTGTAAAAGG + Intergenic
1000737193 5:164919516-164919538 GAATATGACCATTGTGTACCTGG - Intergenic
1001048588 5:168395479-168395501 AAATAACATCATTTTGTTCAAGG + Intronic
1001974806 5:175988977-175988999 AAATATTAACATTTTGGAGATGG - Intronic
1002242628 5:177854801-177854823 AAATATTAACATTTTGGAGATGG + Intergenic
1002517143 5:179767135-179767157 AAATTAGGGAATTTTGTACATGG - Intronic
1004740471 6:18455646-18455668 AAATAACATCATTTTTTACATGG + Intronic
1005217860 6:23553201-23553223 AAATATGAACAAAGTGTACAGGG - Intergenic
1005488703 6:26325791-26325813 AAAAATAAGCACTTTGTATATGG - Intergenic
1010696881 6:78986524-78986546 AAATTTGAGAATTTTGCCCAAGG + Intronic
1012131853 6:95504407-95504429 AAATATCATCATTTTGTTCCAGG - Intergenic
1013946942 6:115732653-115732675 AAATATCAGCAGTTTTGACATGG - Intergenic
1014962965 6:127710272-127710294 AAAGAAAAGCATTTTGTCCACGG - Intronic
1016090471 6:139971975-139971997 AAATATTAGCAATTTATATATGG - Intergenic
1016174770 6:141067836-141067858 AAATCTGAGCATTTTGTGAAAGG + Intergenic
1016547031 6:145235726-145235748 AAAAATTAGCATATTGAACACGG + Intergenic
1017701323 6:157075403-157075425 AAATATGAAAATTTTCTACTAGG + Intronic
1018877234 6:167833368-167833390 ACAAATGAGCATTTTTTTCACGG - Intronic
1019002395 6:168765354-168765376 AAACATTATGATTTTGTACATGG - Intergenic
1021114301 7:16730975-16730997 AAATATAAGCATTCACTACAGGG - Intergenic
1021684050 7:23164410-23164432 AATAATGATCATATTGTACAGGG - Intronic
1022656266 7:32322274-32322296 AATTATGAGCTTTTTGAACGTGG - Intergenic
1022684953 7:32588294-32588316 AAATATTAGTATTTTGTAGCTGG + Exonic
1022772365 7:33487671-33487693 AAATGTGAGCATAGGGTACAAGG - Intronic
1023079925 7:36516861-36516883 AGATATGAGCATTTGGTAACTGG + Intronic
1023675558 7:42626187-42626209 AAATATGAGCACATAGCACAGGG - Intergenic
1024353221 7:48388975-48388997 AAATATGAGCATTATTTTTAGGG + Intronic
1024603173 7:51004370-51004392 AAAAATGAGCTTTTTGTGGAGGG + Intergenic
1026239314 7:68558323-68558345 AGATATGATCATTTTATAAATGG - Intergenic
1026450598 7:70525880-70525902 AAACAGGAGCATTCTGGACAGGG + Intronic
1027519487 7:79187381-79187403 AAATCTGACCAATCTGTACAAGG + Intronic
1027824153 7:83089425-83089447 AGAAATGAGCATTTTGGTCAGGG - Intronic
1030265512 7:107616691-107616713 AAATCTGAGAATCTTATACAGGG - Intronic
1030418464 7:109275706-109275728 AAAAATGATCAATTTGTGCATGG - Intergenic
1030626373 7:111850008-111850030 AAATAGCAGCAATTTTTACAAGG - Intronic
1032339293 7:131055950-131055972 AAATATGAGCCTTGAGTTCAGGG - Intergenic
1032378796 7:131453364-131453386 ACATATGAGAATTTAGTATATGG + Intronic
1032978193 7:137250026-137250048 TATTATGAGCATTTCTTACATGG + Intronic
1032987394 7:137353531-137353553 AAATGGGAGTATTTTGTACCTGG + Intergenic
1033524950 7:142202290-142202312 AAATATTATCATTTTATATAAGG - Intronic
1033633907 7:143190182-143190204 AAAAATGAGAATTTAGTATATGG + Intergenic
1035565937 8:641350-641372 AAATATAAGCAGTGTTTACAGGG + Intronic
1037792878 8:21962552-21962574 AAAGATAAGCATTTTTTAAAAGG - Intronic
1038463149 8:27733674-27733696 TAATATGATCATTTTGAATATGG + Exonic
1040098445 8:43473517-43473539 AAAGATGAGCATTTAATAAAGGG + Intergenic
1040571052 8:48611029-48611051 AAAGATGGGCATTTTGATCAAGG + Intergenic
1041517779 8:58720422-58720444 ATATATCATCATTTTTTACATGG - Intergenic
1042144307 8:65712238-65712260 AAATACTAGCATTGAGTACAAGG + Intronic
1042179269 8:66069163-66069185 AAATATGAGTATATTTTAGAAGG + Intronic
1045373370 8:101547699-101547721 AAAAAAGGGCATTTTGTAAATGG - Intronic
1045626305 8:104055967-104055989 ACATACGAACATTTTGTAAAGGG + Intronic
1045949893 8:107839777-107839799 AGACAAGAGTATTTTGTACAAGG + Intergenic
1046158169 8:110321730-110321752 ATACATAAGCACTTTGTACAAGG + Intergenic
1046283922 8:112071301-112071323 AAATATGGGTATTTTGTAATTGG - Intergenic
1046847819 8:118938108-118938130 AAAAAGGAGTATTTTGAACATGG + Intronic
1046912289 8:119641678-119641700 AAACATCAGCATTTTAAACAAGG - Intronic
1046940568 8:119926952-119926974 GAAAATGAGCATTTTGGGCATGG - Intronic
1048540125 8:135334748-135334770 CAATATGAGCAATTGGTACTGGG - Intergenic
1049270750 8:141694688-141694710 AAAAATTTGCAATTTGTACAGGG - Intergenic
1050568477 9:6912575-6912597 AACAATGAACAATTTGTACATGG - Intronic
1051760962 9:20463812-20463834 AAATATGAATATTTTGCCCAAGG - Intronic
1052102126 9:24461027-24461049 AAATCTCACCACTTTGTACAAGG - Intergenic
1053628046 9:39897062-39897084 GATGATGAGCATTTGGTACAAGG + Intergenic
1054215841 9:62353639-62353661 GATGATGAGCATTTGGTACAAGG - Intergenic
1054671641 9:67801711-67801733 GATGATGAGCATTTGGTACAAGG + Intergenic
1056737491 9:89222462-89222484 AATTATAAACATTTTGCACATGG + Intergenic
1058799709 9:108533476-108533498 AAATATGAGCTTTCAGTTCATGG - Intergenic
1058896916 9:109408483-109408505 AAATGTGAGTCTTTGGTACAGGG + Intronic
1186305160 X:8248578-8248600 AAATTTGGACTTTTTGTACATGG + Intergenic
1188682057 X:33021498-33021520 AAATATGATTACTTTGTAAAGGG - Intronic
1188822928 X:34797323-34797345 AAATATGATCACTCTGTTCAGGG + Intergenic
1189575401 X:42347227-42347249 ACATATGAAAATTTTGTAAAAGG - Intergenic
1189632669 X:42971841-42971863 TTATATGAAGATTTTGTACAAGG + Intergenic
1190485159 X:50916544-50916566 AAATGGGAGTATTTTGTACAAGG + Exonic
1193705479 X:84816142-84816164 AAATCTTAGCATGTTGTAGATGG - Intergenic
1193855824 X:86600424-86600446 AACTATCAGCATTCTGCACAGGG - Intronic
1194538461 X:95138470-95138492 AAATGTGACCATTTTGTAAGGGG + Intergenic
1195863481 X:109406100-109406122 GTATATGTGCATTTTTTACAGGG - Intronic
1196070842 X:111519860-111519882 AAATATGAGCTTTGTTTAAAAGG + Intergenic
1196228812 X:113197072-113197094 AAAATTGAGCATTTTGCACTTGG + Intergenic
1196638180 X:118028615-118028637 TAATATGAACATTAAGTACAGGG - Intronic
1197234747 X:124048312-124048334 AAATATGAGGAATTTAGACATGG - Intronic
1198422830 X:136484897-136484919 GAGTATGTGCATTTTGAACAAGG - Intergenic
1198675879 X:139129627-139129649 AAATGTGAGAATTTTGAACTTGG - Intronic
1198769279 X:140111670-140111692 AAATATGTGCAGGTTGTAGATGG + Intergenic
1198832757 X:140768227-140768249 AAATATGATCAGGTTGTAAAGGG + Intergenic
1201450510 Y:14107497-14107519 AAAGATGAGCATTTTCAAAAGGG - Intergenic