ID: 1117880641

View in Genome Browser
Species Human (GRCh38)
Location 14:60310060-60310082
Sequence CTGCCTTTGAACTGCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117880641_1117880644 16 Left 1117880641 14:60310060-60310082 CCAGAGTAGCAGTTCAAAGGCAG No data
Right 1117880644 14:60310099-60310121 TTTTAATTATATGCAAATTAAGG 0: 70
1: 194
2: 196
3: 361
4: 1122
1117880641_1117880646 18 Left 1117880641 14:60310060-60310082 CCAGAGTAGCAGTTCAAAGGCAG No data
Right 1117880646 14:60310101-60310123 TTAATTATATGCAAATTAAGGGG 0: 68
1: 180
2: 222
3: 365
4: 1162
1117880641_1117880645 17 Left 1117880641 14:60310060-60310082 CCAGAGTAGCAGTTCAAAGGCAG No data
Right 1117880645 14:60310100-60310122 TTTAATTATATGCAAATTAAGGG 0: 78
1: 185
2: 201
3: 352
4: 1009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117880641 Original CRISPR CTGCCTTTGAACTGCTACTC TGG (reversed) Intergenic
No off target data available for this crispr