ID: 1117896579

View in Genome Browser
Species Human (GRCh38)
Location 14:60493913-60493935
Sequence GGAACACTGTTAGTAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896573_1117896579 22 Left 1117896573 14:60493868-60493890 CCACAGTCTTGTTTTCTTCCAAG 0: 1
1: 1
2: 6
3: 47
4: 397
Right 1117896579 14:60493913-60493935 GGAACACTGTTAGTAGCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 85
1117896577_1117896579 4 Left 1117896577 14:60493886-60493908 CCAAGAAGTGAGGGAAACTGGTG 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1117896579 14:60493913-60493935 GGAACACTGTTAGTAGCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896579 Original CRISPR GGAACACTGTTAGTAGCTCC TGG Intronic
903927600 1:26841721-26841743 GGAGCAATGTCAGTGGCTCCTGG + Intronic
906156833 1:43618899-43618921 GGAACAGTGCTAGGAGCTTCAGG + Intronic
908000100 1:59671347-59671369 GAAACACTGTTAGTATCCCAAGG - Intronic
914252963 1:145936967-145936989 GAAAAACTGTCATTAGCTCCTGG + Exonic
918369373 1:183843699-183843721 GGAACACTGTTATTATCACAAGG + Intronic
919473615 1:198008934-198008956 TAAACACTGTTCTTAGCTCCAGG - Intergenic
921058498 1:211563040-211563062 GGAACACTGCTAGCTGCTCTGGG - Intergenic
923715902 1:236424702-236424724 GGAAAACTCCTAGTAGCCCCGGG - Intronic
1064799065 10:19048159-19048181 GGAACACTGTTCTTAGCAGCAGG + Intergenic
1065199335 10:23298611-23298633 GGAACGCTCTTAGTTGCTTCAGG + Intronic
1074182585 10:111077312-111077334 GGCACACTGTGCGGAGCTCCGGG - Exonic
1080869679 11:36226403-36226425 GGAACACAGGTAGTACCTCTGGG - Intronic
1081851374 11:46277436-46277458 GGAACACTGTTATCGGTTCCAGG + Intergenic
1082741798 11:56918991-56919013 GGAATTTGGTTAGTAGCTCCAGG - Intergenic
1083196758 11:61092703-61092725 GGAAAACTGAAAGTAGCTCAGGG - Intergenic
1085249448 11:75132719-75132741 GGGCCACTGTTAGCAGCTTCAGG + Intronic
1087326662 11:96732182-96732204 TGAACACAGTAAGTACCTCCTGG - Intergenic
1088497796 11:110449317-110449339 GCAACACTGATATTAGCCCCTGG - Intronic
1088973162 11:114791219-114791241 GGAACCCTGTTAATAGCCCAAGG - Intergenic
1089803774 11:121063914-121063936 GGAACCCTGGTGGTATCTCCTGG - Intronic
1090601208 11:128373814-128373836 TGAACACTGCTAGCAGCTCTGGG + Intergenic
1092306926 12:7310834-7310856 GGAACACTGTCAGTTGATCTGGG + Intronic
1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG + Intronic
1095083200 12:38031060-38031082 GGAACACTTTTAGTTGCTTTAGG + Intergenic
1095125535 12:38472361-38472383 GGAACACTCTTAGTTGCTTTAGG - Intergenic
1096351845 12:50907286-50907308 GGAACCCTGTTAGTTGCTTTAGG + Intergenic
1097629453 12:62042265-62042287 GGAACACTGTTAACAGTTCTAGG + Intronic
1108356233 13:49630882-49630904 GGACCACTGCTGGGAGCTCCGGG + Exonic
1108852330 13:54747391-54747413 GTAACACTGTAAATATCTCCTGG + Intergenic
1114191279 14:20441101-20441123 GAAACACTGTTCGTAGTTCTGGG - Intergenic
1114297472 14:21342655-21342677 GGAACAATGTGCGTCGCTCCAGG - Intronic
1116242353 14:42361441-42361463 GGAGCACTGTAAGTTGCTCTGGG + Intergenic
1117896579 14:60493913-60493935 GGAACACTGTTAGTAGCTCCTGG + Intronic
1123692748 15:22852718-22852740 GGGACACTCGTGGTAGCTCCCGG + Intronic
1123964470 15:25440981-25441003 GGAACACTGCTAGTATCTTAAGG - Intergenic
1127974156 15:63984772-63984794 GGTACACTCTTAGTGGCTCTGGG + Intronic
1135231431 16:20711768-20711790 GGAACACTGTGAGTTGATCTGGG + Intronic
1141685186 16:85566067-85566089 CGAACACTGTCAGCAGCCCCAGG - Intergenic
1144311985 17:14022620-14022642 GCAACAATGTTAGTAACTCAAGG + Intergenic
1144332773 17:14238699-14238721 GCAACAATGTTAGTAACTCAAGG - Intergenic
1147035202 17:37674790-37674812 AGAACACAGTTAGTAGGTCCTGG + Intergenic
1148771094 17:50066967-50066989 TGAACACTGTTTTAAGCTCCAGG + Intronic
1152047167 17:77944747-77944769 GCAACACTGTGACTGGCTCCAGG + Intergenic
1153401779 18:4689967-4689989 GGAACGCTGTTAGTTGCTTTAGG - Intergenic
1156938006 18:42734381-42734403 GGAAGTTTGTCAGTAGCTCCAGG - Intergenic
1161785010 19:6319182-6319204 GGGACACTGTTGATAACTCCTGG - Intronic
925503748 2:4536541-4536563 AGCATCCTGTTAGTAGCTCCAGG - Intergenic
926090711 2:10047408-10047430 GGAACTCTGAGAGGAGCTCCTGG - Intronic
927834269 2:26379508-26379530 GGAACAGTGTTATTAGGTACTGG + Intronic
930763224 2:55058786-55058808 GCAGCTCTGTTAGTTGCTCCTGG + Intronic
931591634 2:63889879-63889901 AAAACAATGTTTGTAGCTCCTGG + Intronic
1172881399 20:38202234-38202256 GCAACACTGTGAGTAACCCCAGG - Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1177896489 21:26859981-26860003 GGAACACTCTTAGTTGCTTTAGG - Intergenic
1178691092 21:34750804-34750826 GTCACACTGTTAGTAGTTGCTGG + Intergenic
1179154074 21:38834827-38834849 GGGACACTGTTTGTAGAACCTGG + Intergenic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1183804057 22:40193242-40193264 TGAACACTGTGAGTTCCTCCTGG - Intronic
950376889 3:12579696-12579718 GGGACACTGGGAGTGGCTCCTGG + Intronic
953363599 3:42322635-42322657 GGAACGCTGTCAGTAGCACCTGG - Intergenic
954733738 3:52687315-52687337 GGAGCACTGTTTGGAACTCCTGG - Exonic
956302385 3:67786482-67786504 GGAACCCTGTTAGGTGCTCAGGG + Intergenic
957000048 3:74874892-74874914 GGAACACTCTTAGTTGCTTTAGG + Intergenic
961051435 3:123750392-123750414 GGAAAATTTTTAGTAGCTCATGG - Intronic
962226411 3:133614192-133614214 GGAGCACTTTAAGTAGTTCCTGG - Intronic
972916380 4:43884957-43884979 GGAAAACTGTTAGTAGAACTGGG + Intergenic
973260203 4:48155732-48155754 GGAACTGTGTGAGTAGCTGCTGG + Intronic
979473236 4:121125528-121125550 GGAACACTGTAAGCCACTCCTGG + Intergenic
980314398 4:131178070-131178092 GGAAAAAAGTGAGTAGCTCCAGG + Intergenic
981216211 4:142171584-142171606 TGAGCACTGTTAGTATCTCATGG - Intronic
988467135 5:31501651-31501673 GGAACTCTGATTGTAGCTGCCGG + Intronic
1003007650 6:2396727-2396749 AGAACAATGGTAGGAGCTCCAGG + Intergenic
1011481147 6:87795302-87795324 GAAGCAGTGTTAGTAGCACCTGG + Intergenic
1014539939 6:122663387-122663409 GGTAGACTCTTAGCAGCTCCTGG - Intronic
1018723119 6:166588875-166588897 GGAACACAGGTAGTCGCACCTGG - Intronic
1028268295 7:88756181-88756203 GGAACACTGTGAGGAGCACAGGG + Intergenic
1028960219 7:96740308-96740330 TGAAAACTGTGAGAAGCTCCTGG + Intergenic
1031264791 7:119568757-119568779 GGAACACTGTTGGTTGCTGTAGG - Intergenic
1032558771 7:132865737-132865759 GGAACAGTGGTAGAAGCTCGGGG - Intronic
1039068849 8:33632408-33632430 GGCACTCTGTATGTAGCTCCAGG + Intergenic
1042691276 8:71501975-71501997 AGAGCACTGTTAGTAGGTCCTGG - Intronic
1043165916 8:76902272-76902294 AGAACACTGTCATTTGCTCCTGG - Intergenic
1048721776 8:137333955-137333977 GGCACAATGGTATTAGCTCCAGG + Intergenic
1051227358 9:14915021-14915043 GGAAAACTCTTAGTTGCTACTGG + Intergenic
1190879094 X:54479977-54479999 GGAACCCTGTGGGTAGCTCAGGG + Intronic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1194775200 X:97954602-97954624 GTAACATTGTTAATATCTCCAGG - Intergenic
1196846343 X:119899467-119899489 GGCCCACTGTTACTAGCCCCGGG - Intronic
1197322797 X:125053539-125053561 GGTACACTGGTAGTGGCTGCAGG + Intergenic
1197739367 X:129877499-129877521 GGAACAGTCTCAGTAGCACCTGG - Intergenic