ID: 1117896716

View in Genome Browser
Species Human (GRCh38)
Location 14:60495121-60495143
Sequence CTGTTCCAATGTAAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896716_1117896723 15 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896723 14:60495159-60495181 GGCACGGTAATGCATTTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1117896716_1117896719 -1 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896719 14:60495143-60495165 GTCTCTCCCGAGTGTGGGCACGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117896716_1117896722 14 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 94
1117896716_1117896717 -7 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896717 14:60495137-60495159 GGAACAGTCTCTCCCGAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 66
1117896716_1117896718 -6 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896718 14:60495138-60495160 GAACAGTCTCTCCCGAGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896716 Original CRISPR CTGTTCCAATGTAAGATCTA TGG (reversed) Intronic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
901364565 1:8735195-8735217 TTGTTACAATCTAAAATCTAAGG + Intronic
910441036 1:87252292-87252314 CAATTCCAATATAAGATGTAAGG - Intergenic
917121605 1:171649390-171649412 CTGTTTCAAGGCCAGATCTAGGG - Intronic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
922280490 1:224118826-224118848 ATTTTCCAAGGTAAGTTCTATGG - Intronic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
1068322362 10:55435770-55435792 CTCTGCCAATGTACTATCTATGG - Intronic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1082696400 11:56370457-56370479 CTGTTCCAATATAATATTTATGG + Intergenic
1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG + Exonic
1088669975 11:112131421-112131443 CTGTTCCAGGGGAAGATCTGGGG - Intronic
1089665656 11:120016853-120016875 CTCTCCCAATGTAAGATCCCAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090563658 11:127962505-127962527 CTGTTCCAAAGTTGGATTTATGG + Intergenic
1091105385 11:132914404-132914426 CTGTTCCAATATAATATTTATGG + Intronic
1097637028 12:62135110-62135132 CTTTTCCATGGTAAGCTCTATGG + Intronic
1097974977 12:65675685-65675707 CTTTTCCATTGTAAGATCACTGG - Intergenic
1101101071 12:101393237-101393259 CTGTTGAAATGTAAGCTCTGAGG - Exonic
1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG + Intronic
1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG + Intronic
1107987757 13:45790310-45790332 CTGTTTCAAACCAAGATCTATGG + Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110474408 13:75896984-75897006 CTGTTGCAATGACAGATCTCTGG + Intergenic
1114713015 14:24797355-24797377 CTGTTCCTCTGGAAGCTCTAGGG + Intergenic
1115739398 14:36372461-36372483 CTGTTCCTTTGTAAGAACCAAGG + Intergenic
1116524744 14:45890877-45890899 CTGTTCCAATATATGATCATGGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG + Exonic
1125898451 15:43323064-43323086 CTGTTCAAATGTAAATTCAATGG + Intergenic
1130154338 15:81336743-81336765 ATGGTCCAAGGTAAGAACTATGG - Intronic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1141359692 16:83384129-83384151 CAATTCCAATCTAATATCTAAGG + Intronic
1144355162 17:14438335-14438357 CTGATCCTATGTAAGAACTGGGG + Intergenic
1150239516 17:63621145-63621167 CTGTTCCAGTGTAATATGTCAGG - Intergenic
1154997128 18:21651171-21651193 CTATTTCAATGTAAGTTATAAGG - Exonic
1156333753 18:36150303-36150325 CAGTTCCAGTGTCAGTTCTAGGG + Intronic
1157870294 18:51224104-51224126 CTCTTGAAATGTAAGATATAGGG - Intergenic
928726978 2:34185846-34185868 TTGCTGCAATGTAAGCTCTAGGG - Intergenic
929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG + Intronic
940672071 2:156682816-156682838 CTGTCACTTTGTAAGATCTATGG - Intergenic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
944909138 2:204292168-204292190 TTGTCCCTATGTAAGATTTATGG - Intergenic
945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG + Intergenic
947536211 2:230941861-230941883 ATCTTACATTGTAAGATCTAAGG + Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG + Intronic
1172185600 20:33029225-33029247 CTGTTCCAATGTAAATAGTATGG - Intergenic
1172822017 20:37744932-37744954 CTGTTTCAGTGTATGATATAAGG - Intronic
1173574827 20:44105842-44105864 CTGTTAAAATGTATGATCCAGGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1176961457 21:15163718-15163740 ATGTTACAATGTAAAATATAGGG - Intergenic
1183150577 22:36034038-36034060 CTTGTCCAAGGTAAGATATATGG - Intergenic
953570306 3:44066073-44066095 CAGTTCCAGTGTAAGTTCCAGGG - Intergenic
954772715 3:52987095-52987117 CTGTCCCACTGGAAGATCTTCGG + Intronic
956128885 3:66036904-66036926 CTGTACCAAAGTGAGATGTAAGG + Intronic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
962728309 3:138256049-138256071 CTGCTCCAATGTAAGATGTTTGG - Intronic
964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG + Intronic
972699758 4:41482735-41482757 CTGCTCCATTGTAAGAGCTCAGG - Intronic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
973649855 4:52987854-52987876 CTGATCCACTGTAATAGCTAGGG + Intronic
973895507 4:55408647-55408669 CTGTTCCTCTGTAAAATGTAGGG - Intronic
975072896 4:70164385-70164407 CTGATCCAATGTAGGATATAGGG - Exonic
975210091 4:71689885-71689907 ATGTACCAATATAAGACCTATGG + Intergenic
976734037 4:88292665-88292687 CTGTTCCACTGTATGGCCTAAGG - Intergenic
981790370 4:148529585-148529607 TTGTCCCACTGTAAGGTCTATGG - Intergenic
983373142 4:166890029-166890051 TTATTCCAATGTAAGACCTATGG - Intronic
985207821 4:187559376-187559398 CTGATCATATGTAAGATCAAAGG + Intergenic
993042400 5:82829911-82829933 CTGTTAGAATATAAGATCCATGG - Intergenic
993607555 5:90012359-90012381 CTTTTTAAATTTAAGATCTATGG - Intergenic
994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG + Intergenic
995424598 5:112006087-112006109 CTCTTCCATTGTAAAATCTTAGG - Intergenic
995764749 5:115602691-115602713 CTGTACCTCTGAAAGATCTACGG - Intronic
996558906 5:124807777-124807799 ATGTCCTAATTTAAGATCTATGG + Intergenic
998881585 5:146650757-146650779 CTTTTCCTATGGAAGATCTTTGG - Intronic
1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG + Intergenic
1000962800 5:167620174-167620196 ATGTACCATTGTCAGATCTAAGG - Intronic
1001556338 5:172640106-172640128 CTGTACCATTGGAAGATCTTGGG + Intergenic
1007189469 6:40001080-40001102 ATGTTCAAATGTAAGAACTCAGG - Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1012875898 6:104725787-104725809 CTGTACCAATTTACAATCTAAGG + Intergenic
1020195629 7:6036092-6036114 CAGTTGCAATGTAAGAGATACGG + Exonic
1027580209 7:79983618-79983640 CTGTTCCAAAGTCAGATATTGGG - Intergenic
1028580386 7:92403728-92403750 CTGTTACAATGTAAAATAAATGG + Intergenic
1030414540 7:109225771-109225793 CTGTTCCATTGTATTATGTAAGG + Intergenic
1033180130 7:139168985-139169007 CTGTTCCAAGGTCTGATATATGG + Intronic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1039130897 8:34262951-34262973 CTTTTCAGATGAAAGATCTAAGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG + Intergenic
1059508496 9:114821733-114821755 CTGTCCCATTGGAAGGTCTATGG + Intergenic
1060911135 9:127352041-127352063 CTGTTCCTATGTAAAATGAAGGG + Intronic
1060918701 9:127405849-127405871 CTCTTCCCATGTAAGACCTTAGG - Intronic
1187313641 X:18171057-18171079 CTGGTCCAAAGTAACGTCTATGG - Exonic
1194926141 X:99826599-99826621 CAGTTCCAATGGAAGAACTGTGG + Intergenic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic
1197994844 X:132361993-132362015 TTGTTCCAGTGTAAGTCCTAGGG - Intergenic