ID: 1117896717

View in Genome Browser
Species Human (GRCh38)
Location 14:60495137-60495159
Sequence GGAACAGTCTCTCCCGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896714_1117896717 14 Left 1117896714 14:60495100-60495122 CCTTTGGTAGAAAAAGCTTGGCC 0: 1
1: 1
2: 3
3: 24
4: 159
Right 1117896717 14:60495137-60495159 GGAACAGTCTCTCCCGAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 66
1117896716_1117896717 -7 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896717 14:60495137-60495159 GGAACAGTCTCTCCCGAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896717 Original CRISPR GGAACAGTCTCTCCCGAGTG TGG Intronic
913581667 1:120233090-120233112 AGAACAGTCCCTCCCTTGTGCGG + Intergenic
913626510 1:120665298-120665320 AGAACAGTCCCTCCCTCGTGCGG - Intergenic
914563598 1:148844537-148844559 AGAACAGTCCCTCCCTTGTGCGG + Intronic
914609229 1:149285689-149285711 AGAACAGTCCCTCCCTTGTGCGG - Intergenic
915895783 1:159809633-159809655 AGAACAGTGTCTCCAGAGAGAGG + Exonic
916550911 1:165849193-165849215 GGTACAGTCTACCCAGAGTGGGG + Intronic
922067253 1:222156308-222156330 GGAACAGTCTCTTAAGAGTTAGG + Intergenic
922182257 1:223244506-223244528 GGAACAGTCTCTATCAAGAGAGG + Intronic
923138835 1:231142861-231142883 TGCACTGTCTCTCCCGAGTGAGG + Intergenic
924494724 1:244575861-244575883 GGTTCAGTCTCTCCCTAATGGGG + Intronic
1069371352 10:67750852-67750874 GGATCAGTTTCTCCTGTGTGAGG - Intergenic
1073210752 10:101800161-101800183 AGAACACTGTCTCCCGGGTGTGG - Intronic
1081596654 11:44463969-44463991 GGGACAGGCTCTCCAGGGTGGGG + Intergenic
1085034892 11:73293776-73293798 GGATCAGTCTCACCAGGGTGTGG + Intronic
1095965557 12:47864783-47864805 GGAAGGGTCCCTCCAGAGTGGGG - Intronic
1096572162 12:52529870-52529892 GGAAGAGGGTCTCCAGAGTGTGG - Intergenic
1096753152 12:53776106-53776128 GAAACAGTCTCTCCCAAAGGAGG - Intergenic
1098864294 12:75744583-75744605 GGTACAGTCTTCGCCGAGTGAGG + Intergenic
1103685633 12:122730067-122730089 GGGACATTCCCTGCCGAGTGGGG - Exonic
1104724930 12:131070192-131070214 GGACCTGTCACACCCGAGTGGGG + Intronic
1104802121 12:131560971-131560993 GGACCTGTCACACCCGAGTGGGG - Intergenic
1113541691 13:111114782-111114804 GGAACCGACTCTCCGGAGCGCGG - Intronic
1117896717 14:60495137-60495159 GGAACAGTCTCTCCCGAGTGTGG + Intronic
1121556889 14:94844871-94844893 AAAACACTCTTTCCCGAGTGGGG - Intergenic
1129190140 15:73932549-73932571 AGCAGAGTCTCTCCCCAGTGTGG + Intronic
1133974843 16:10593259-10593281 GGAACATTCTCTGCAGAGTCTGG - Intergenic
1138421902 16:56904487-56904509 GGACCAGTCTGTCCAGAGTCAGG + Intronic
1138779071 16:59760732-59760754 GGAACAATCACTTCCGACTGAGG + Intergenic
1147211291 17:38873953-38873975 GGGACAGGCTGTCCCAAGTGAGG + Intronic
1150820441 17:68430254-68430276 GGCACAGTCTCTCCCTGCTGCGG - Intronic
1151562858 17:74879890-74879912 GGAAGGGTCTCTCCAGAATGAGG - Intronic
1152328981 17:79659626-79659648 GGATCAGTCTCTGGGGAGTGGGG - Intergenic
1155608716 18:27637807-27637829 GGAACAAGTTCTCCCAAGTGTGG - Intergenic
1161640825 19:5421719-5421741 GGAAAAGTCTCTCCCCATTCTGG - Intergenic
1162457568 19:10795280-10795302 GGAACGTTCTCTCCCACGTGTGG - Intronic
1167423117 19:49415321-49415343 GGCCCAACCTCTCCCGAGTGTGG - Intronic
927476773 2:23419799-23419821 GGAACAGAATCGCCTGAGTGGGG - Intronic
937973185 2:127565613-127565635 GGCACAGTCTCTGCTCAGTGAGG + Intronic
939796467 2:146651295-146651317 GGAACAGTCTCTACCATGTTTGG - Intergenic
943712851 2:191117061-191117083 GGAACAGAATCTCTGGAGTGGGG + Intronic
1170781459 20:19429504-19429526 AGAACAGTGTCTCCTGAATGAGG - Intronic
1171278234 20:23876426-23876448 GGAACAGTCACTGCCCAGTTGGG - Intronic
1171293189 20:23994250-23994272 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1174521304 20:51132691-51132713 GGAACAGTCCCTCCCAAGCCGGG - Intergenic
1174609934 20:51790700-51790722 GGAACGGTCTCTCCCCGGTGTGG + Exonic
1180824248 22:18851964-18851986 AGAACAGCCTCTCCCCAGTGGGG + Intronic
1181124676 22:20695118-20695140 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1181188488 22:21122584-21122606 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1181210712 22:21287909-21287931 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1181398798 22:22638979-22639001 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1181501529 22:23318335-23318357 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1181650624 22:24257080-24257102 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1181706757 22:24653658-24653680 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1203216235 22_KI270731v1_random:7521-7543 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1203274385 22_KI270734v1_random:77868-77890 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
949903328 3:8837947-8837969 GGACCAGTCTCTCCAGGGTCAGG + Intronic
957760460 3:84548743-84548765 GGAACAGTTTCTGCGGAATGTGG - Intergenic
968717387 4:2170712-2170734 GGAACAGTCTCCCCAGAACGGGG - Exonic
972666489 4:41170100-41170122 GGCACAGTCTCTGCTAAGTGAGG + Intronic
979443731 4:120785067-120785089 GGAACGGTCTCTCCTCAGAGTGG + Exonic
985025809 4:185737918-185737940 GGCACAGGCGCTCCCCAGTGTGG + Intronic
991776715 5:70092224-70092246 GGAACAGTTTCTACTGAATGCGG - Intergenic
991856002 5:70967671-70967693 GGAACAGTTTCTACTGAATGCGG - Intergenic
997622872 5:135310737-135310759 GAAACAGTCTCGCCGAAGTGGGG + Intronic
1002929283 6:1622283-1622305 GGAATAGTCTCTCCTGGGTGTGG + Intergenic
1004971472 6:20915339-20915361 GGAACTGGCTCTCACGACTGTGG + Intronic
1006727517 6:36210577-36210599 GGAACAGAGTCTACAGAGTGAGG + Intronic
1011718459 6:90131021-90131043 GGAAGAGTCACTCCTGAGAGCGG + Intronic
1016272871 6:142309635-142309657 GGAAGAGTCTTACCTGAGTGAGG - Exonic
1017995706 6:159530053-159530075 GGAAAATTCTCTCTCGAGAGTGG + Intergenic
1029527580 7:101104445-101104467 GCAACAGGCTCTCCCGTGGGTGG - Intergenic
1032719202 7:134537068-134537090 GGATCAGTTTCTCCTGTGTGAGG - Exonic
1032724171 7:134575838-134575860 GGATCAGTTTCTCCTGCGTGAGG - Exonic
1034732482 7:153400045-153400067 GGGACACTCTCTCCCCCGTGAGG + Intergenic
1050069045 9:1791373-1791395 GAAACTGTCTCTCACCAGTGTGG - Intergenic
1055552031 9:77440307-77440329 GTGACAGTCCCTGCCGAGTGTGG + Intronic
1056233362 9:84569111-84569133 GCCACAGTCTCTCCAGAGTCTGG - Intergenic
1062059422 9:134486903-134486925 GGACCAGGCTCTGCCCAGTGTGG + Intergenic
1186513763 X:10150629-10150651 GACACAGTCACTCCCGAGCGTGG + Intergenic
1198019582 X:132644886-132644908 GCAGCAGTCTCTCCTGACTGGGG - Intronic
1200150498 X:153949067-153949089 GCAAAAGTCTCTCCCCAGGGTGG + Exonic