ID: 1117896718

View in Genome Browser
Species Human (GRCh38)
Location 14:60495138-60495160
Sequence GAACAGTCTCTCCCGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896714_1117896718 15 Left 1117896714 14:60495100-60495122 CCTTTGGTAGAAAAAGCTTGGCC 0: 1
1: 1
2: 3
3: 24
4: 159
Right 1117896718 14:60495138-60495160 GAACAGTCTCTCCCGAGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1117896716_1117896718 -6 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896718 14:60495138-60495160 GAACAGTCTCTCCCGAGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896718 Original CRISPR GAACAGTCTCTCCCGAGTGT GGG Intronic
900952037 1:5863684-5863706 GCAAAGTTTCTCCTGAGTGTGGG - Intronic
906606552 1:47176518-47176540 CAACAGTCTCAGCAGAGTGTTGG + Intergenic
910335884 1:86130961-86130983 GAACAACATTTCCCGAGTGTTGG + Intronic
913581668 1:120233091-120233113 GAACAGTCCCTCCCTTGTGCGGG + Intergenic
913626509 1:120665297-120665319 GAACAGTCCCTCCCTCGTGCGGG - Intergenic
914563599 1:148844538-148844560 GAACAGTCCCTCCCTTGTGCGGG + Intronic
914609228 1:149285688-149285710 GAACAGTCCCTCCCTTGTGCGGG - Intergenic
915420907 1:155780667-155780689 AAACAGTCTCTCAGGAGGGTAGG - Intronic
915955054 1:160214133-160214155 GCACAGTCTCTCCAGAGTACAGG - Exonic
923104546 1:230844033-230844055 GAACTGTCTGTCCTGAGTGGTGG + Intronic
923650398 1:235867603-235867625 GACCAGTCCCTCCAGAGGGTGGG + Intronic
1067469881 10:46528458-46528480 GGACAGTCTCTCCCATGTGCTGG - Intergenic
1076776445 10:132700513-132700535 TAACATTCTGTCCCTAGTGTGGG + Intronic
1078517030 11:12031575-12031597 GAACAGTCTCTCCTCATAGTAGG - Intergenic
1085034893 11:73293777-73293799 GATCAGTCTCACCAGGGTGTGGG + Intronic
1087915276 11:103802947-103802969 GAACTGTTTCTCCTGAGTGAAGG + Intergenic
1090303154 11:125665029-125665051 GAAGAGACTGTCCCCAGTGTAGG + Intronic
1097186980 12:57201353-57201375 GAACAGTTTATCCCCAGTTTTGG - Intronic
1098594383 12:72255020-72255042 GAACAGTCTCAGTGGAGTGTTGG - Intronic
1112105782 13:96237678-96237700 GAACAGTTTCAACTGAGTGTTGG - Intronic
1112907984 13:104447410-104447432 GAACTGTCCCTCCAGATTGTTGG - Intergenic
1113043740 13:106131621-106131643 GAACAGTTTCTCCTGAGGGAAGG - Intergenic
1114364606 14:22013078-22013100 GAAGGGTCTCTCTCCAGTGTGGG - Intergenic
1116075163 14:40101647-40101669 GAGCAGTCTATCCAGAGTGCAGG + Intergenic
1117896718 14:60495138-60495160 GAACAGTCTCTCCCGAGTGTGGG + Intronic
1123787090 15:23684818-23684840 AAACAATCTCTCCTGAGGGTTGG - Intergenic
1127871814 15:63080296-63080318 GAACAGCCCCTCTCCAGTGTGGG + Intergenic
1129190141 15:73932550-73932572 GCAGAGTCTCTCCCCAGTGTGGG + Intronic
1132958194 16:2607660-2607682 GCACAGTCTCTCACCAGTGCTGG - Intergenic
1136927468 16:34388465-34388487 GAACGGCTTCTCCCCAGTGTGGG + Intergenic
1136977106 16:35023341-35023363 GAACGGCTTCTCCCCAGTGTGGG - Exonic
1137848016 16:51710817-51710839 TAACATTCTCTCCGGAGAGTTGG - Intergenic
1148188768 17:45664398-45664420 TAACAGTGTCTCCCGTTTGTGGG - Intergenic
1161640824 19:5421718-5421740 GAAAAGTCTCTCCCCATTCTGGG - Intergenic
1164082756 19:21874921-21874943 GCACAGTGTCTCCTGAGTGCAGG - Intergenic
1164098240 19:22031074-22031096 AAACAGTCTCACCTGTGTGTTGG + Intergenic
1164190726 19:22914965-22914987 GCACAGTGTCTCCTGAGTGCAGG - Intergenic
1167423116 19:49415320-49415342 GCCCAACCTCTCCCGAGTGTGGG - Intronic
1168251490 19:55144881-55144903 GAAAAGTCTCTCTCGAGTCATGG + Intronic
925103063 2:1265907-1265929 CACCAGTCTCTCCCCAGTGAAGG - Intronic
926982626 2:18587241-18587263 GACCAGTCTCCCCCCTGTGTAGG + Intronic
927909302 2:26885311-26885333 GAACATCCTCTTCCGAGTGCAGG - Intronic
929309113 2:40401244-40401266 GTACAGTTTCTCCGAAGTGTAGG - Intronic
945570596 2:211462592-211462614 GAACAGTCTCTTTTGAGTCTTGG - Intronic
948207805 2:236171879-236171901 GAACAGTCCCTCCCGAGCCCAGG + Intergenic
1170107893 20:12771799-12771821 GAACAGTTTCTGCGGAGTGGTGG + Intergenic
1170781458 20:19429503-19429525 GAACAGTGTCTCCTGAATGAGGG - Intronic
1174609935 20:51790701-51790723 GAACGGTCTCTCCCCGGTGTGGG + Exonic
1174610046 20:51791253-51791275 GAAGGGTCTCTCTCCAGTGTGGG + Exonic
954907977 3:54078785-54078807 GAACAGCCTCCCCCTAGGGTAGG - Intergenic
965924884 3:173965662-173965684 GAAAATTCTCTCCCAATTGTGGG - Intronic
967491965 3:190102925-190102947 GGACAGTCTTTCCTCAGTGTTGG - Intronic
969193471 4:5542613-5542635 GCACAGACTCTCCAGTGTGTAGG - Intergenic
979017686 4:115454931-115454953 TACCAGTCTCTCCTGAGAGTAGG - Intergenic
979443732 4:120785068-120785090 GAACGGTCTCTCCTCAGAGTGGG + Exonic
985025810 4:185737919-185737941 GCACAGGCGCTCCCCAGTGTGGG + Intronic
990607314 5:57423599-57423621 GAAGGGTCTCTCTCCAGTGTGGG - Intergenic
1002929284 6:1622284-1622306 GAATAGTCTCTCCTGGGTGTGGG + Intergenic
1004339614 6:14796804-14796826 GAACAATCTCTGCCCAGTGATGG - Intergenic
1004954248 6:20709915-20709937 GATTATTCTCTCCCGAGTATTGG + Intronic
1004971473 6:20915340-20915362 GAACTGGCTCTCACGACTGTGGG + Intronic
1007164407 6:39818859-39818881 GACAAGCCTCTCCTGAGTGTGGG + Intronic
1017995707 6:159530054-159530076 GAAAATTCTCTCTCGAGAGTGGG + Intergenic
1018703640 6:166447688-166447710 GAACAATCTCTTCAGAGTGTAGG + Intronic
1019694681 7:2438658-2438680 TAAACGTTTCTCCCGAGTGTTGG + Intergenic
1019705568 7:2495739-2495761 AAACAGACTCACCCGACTGTAGG - Intergenic
1024139326 7:46445922-46445944 GAACAGTTTCTGCCGAGTTGTGG - Intergenic
1029323162 7:99783234-99783256 GAAGAGTCACTCCCCACTGTGGG - Intronic
1034627420 7:152504139-152504161 GAACATTCAGTCCCAAGTGTGGG + Intergenic
1037438431 8:18889319-18889341 GAACAGTCTCTCCACAGTCAAGG - Intronic
1041100625 8:54393022-54393044 CAACAGTGTCTCCAGATTGTGGG - Intergenic
1042039425 8:64577044-64577066 GAACATTCTCGGCCGGGTGTTGG - Intergenic
1042755620 8:72207381-72207403 GAAGAGCCTCTACAGAGTGTAGG + Intergenic
1043003714 8:74791899-74791921 GATCAGTCTCTGCTCAGTGTTGG - Intronic
1046908129 8:119596327-119596349 GACCAGTCTCTCCCTAATGCAGG - Intronic
1049558611 8:143296364-143296386 GTACAGCCTCTCCCCGGTGTGGG - Exonic
1050069044 9:1791372-1791394 AAACTGTCTCTCACCAGTGTGGG - Intergenic
1062059423 9:134486904-134486926 GACCAGGCTCTGCCCAGTGTGGG + Intergenic
1200150499 X:153949068-153949090 CAAAAGTCTCTCCCCAGGGTGGG + Exonic