ID: 1117896722

View in Genome Browser
Species Human (GRCh38)
Location 14:60495158-60495180
Sequence GGGCACGGTAATGCATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896716_1117896722 14 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896722 Original CRISPR GGGCACGGTAATGCATTTTG AGG Intronic
904406230 1:30290120-30290142 GGGAAAGGGAATTCATTTTGGGG + Intergenic
904774876 1:32900709-32900731 GGGCACGGTGATGCTGCTTGTGG - Intronic
907448982 1:54530191-54530213 AGACACTGTAATGCATTTAGAGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
911472988 1:98341282-98341304 GTGCAAGGAAATGTATTTTGGGG + Intergenic
912346480 1:108967821-108967843 TGGCAAGGAAATGTATTTTGGGG + Intergenic
916911031 1:169346573-169346595 GAGCAGGGTAATGAATGTTGGGG - Intronic
921635865 1:217492337-217492359 GTGGATGGTAAGGCATTTTGAGG - Intronic
923372911 1:233329737-233329759 GTGCACCGTAATGCACTTTTGGG + Intronic
924504391 1:244667623-244667645 AGGCAGTGTAATGCAGTTTGTGG - Intronic
1066239681 10:33521469-33521491 GAGCACGGAAATTCATCTTGAGG + Intergenic
1067374776 10:45717740-45717762 GGCCCTGTTAATGCATTTTGTGG - Intergenic
1067378952 10:45754809-45754831 GGGCCCTGTTATGCATTTTGTGG + Intronic
1067886654 10:50095472-50095494 GGGCCCTGTTATGCATTTTGTGG + Intronic
1068181677 10:53527574-53527596 TGGCAAGGAAATGTATTTTGGGG + Intergenic
1069178598 10:65326911-65326933 TGGCAAGGAAATACATTTTGGGG - Intergenic
1072122486 10:92416541-92416563 CAGCAGGGTAATGCATTCTGAGG - Intergenic
1073548625 10:104376125-104376147 TGGCAAGGAAATACATTTTGGGG + Intronic
1080108774 11:28541752-28541774 GGGAAGGGTAATGCATTTGCAGG + Intergenic
1080788161 11:35494683-35494705 GGGCAGGGCAATGCATTTATAGG - Intronic
1084933157 11:72572879-72572901 TGGCACGGAAATATATTTTGGGG + Intergenic
1087984960 11:104666775-104666797 GGGAACAGTCATGCATCTTGAGG + Intergenic
1090168635 11:124578537-124578559 GGGCACTGTAATGTTTTTTAAGG + Intergenic
1091851163 12:3698267-3698289 ATGCACTGTCATGCATTTTGTGG + Intronic
1102098997 12:110263116-110263138 TGGCTCGGTAATGAATCTTGGGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105622379 13:22080820-22080842 GGCCATGGCAGTGCATTTTGAGG + Intergenic
1106119768 13:26850489-26850511 TGGCAAGGAAATACATTTTGGGG - Intergenic
1110003421 13:70234745-70234767 GGGCATAGTAGTGCACTTTGGGG + Intergenic
1115950138 14:38711990-38712012 AGGCACAGTGATGCATTCTGAGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG + Intronic
1118330643 14:64813026-64813048 GGATATTGTAATGCATTTTGGGG + Intronic
1122653701 14:103242519-103242541 TGGCAAGGAAATGTATTTTGGGG - Intergenic
1126118080 15:45227043-45227065 TGGCAAGGAAATACATTTTGGGG + Intergenic
1128515095 15:68337160-68337182 GGGCACTGAGATGCAGTTTGAGG + Intronic
1132030696 15:98436478-98436500 GGGCGCAGTATTTCATTTTGGGG + Intergenic
1138363553 16:56453158-56453180 GGGGATGGTCATGAATTTTGGGG - Intronic
1140936371 16:79674307-79674329 AGGCAGGGTAATGCAATGTGTGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1150659729 17:67064844-67064866 TGGCAAGGAAATACATTTTGGGG - Intergenic
1157119184 18:44892609-44892631 TGGCCAGGTAATGTATTTTGTGG + Intronic
1157509667 18:48261798-48261820 GGTCATGGAAAGGCATTTTGGGG + Intronic
928350517 2:30548763-30548785 TGGCAAGGTAATATATTTTGGGG + Intronic
928682261 2:33714549-33714571 TGGCAAGGGAATGTATTTTGGGG + Intergenic
930001362 2:46863867-46863889 GGGCACAGCAATGCTTTCTGAGG + Intergenic
930555995 2:52896311-52896333 GGGCACCGTGAGGCATTCTGGGG - Intergenic
937313655 2:120917477-120917499 GGGCAGGGTACTGCATCTTCAGG - Intronic
938559533 2:132459436-132459458 GGTCAGGGTAAAGCCTTTTGAGG - Intronic
939339138 2:140870380-140870402 GGGGAATGTAAGGCATTTTGAGG - Intronic
939811403 2:146837418-146837440 AGGCAAGGTTATGCTTTTTGGGG - Intergenic
940074417 2:149725029-149725051 GAGCACGCTCATTCATTTTGGGG + Intergenic
941352278 2:164451367-164451389 GGACACGGTGAGGGATTTTGAGG - Intergenic
944362675 2:198876680-198876702 GGGAAAGGTATTGCATTTTTGGG - Intergenic
944897112 2:204176580-204176602 GGGCAAGCTAATGTATTTTGAGG + Intergenic
948439509 2:237977679-237977701 GGGCATGGCAAGGCACTTTGAGG + Intronic
1172170078 20:32924937-32924959 GGGCACAGTGAAGCATTTTAGGG + Intronic
1173730062 20:45322005-45322027 TGGCACAATAATGCATTTAGAGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1178386945 21:32160074-32160096 TGGCAAGGAAATACATTTTGGGG + Intergenic
1183626206 22:39003859-39003881 TGCCACGGTAATGCTTTTTAGGG - Intergenic
950901803 3:16504858-16504880 GGGCAAGGTGCTGCATTCTGTGG - Intronic
967701179 3:192593882-192593904 AGGCAGAGTAATGCAATTTGAGG - Intronic
969129110 4:4978085-4978107 GGGCACGGTCAGGAATTCTGAGG - Intergenic
973855361 4:55005725-55005747 GGGAAAGGTAATGCATTATCTGG + Intergenic
973872806 4:55183495-55183517 GGGCGTGGTAAAGGATTTTGGGG - Intergenic
977237727 4:94528639-94528661 GGGCACTGTTATAGATTTTGGGG + Intronic
977890148 4:102300122-102300144 GGGCACGTGCATGCTTTTTGGGG - Intronic
980344425 4:131594338-131594360 GGGCATGGCATTTCATTTTGGGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
987325156 5:16805793-16805815 GGGCAAGGGAATGTATTTTGGGG - Intronic
988001232 5:25351821-25351843 GGGGATGGTAAAGCATTTTAAGG - Intergenic
992558742 5:77929361-77929383 GGGAAGGGCAATGCAGTTTGGGG + Intergenic
995799956 5:115983269-115983291 GGGCCCTGAAATACATTTTGGGG - Exonic
1003195106 6:3907411-3907433 TGGCAAGGAAATGTATTTTGGGG - Intergenic
1005526261 6:26653208-26653230 AGGCATGACAATGCATTTTGCGG + Intronic
1008667967 6:53735601-53735623 GGGAAAGGTAATGCCTTTTGAGG + Intergenic
1012445462 6:99302752-99302774 GGTCACTGTGATCCATTTTGGGG + Intronic
1020715304 7:11667227-11667249 GGGTAAGGTAATGGACTTTGAGG - Intronic
1026013268 7:66653483-66653505 GGTCTCGGTTATGCTTTTTGTGG + Intronic
1028602850 7:92621206-92621228 TGGCAAGGTAATGCATTCAGAGG + Intronic
1030041480 7:105454515-105454537 TTGCACTGGAATGCATTTTGTGG - Intronic
1033247981 7:139734537-139734559 GAGCATGGGAATGCATTTAGGGG - Intronic
1038836869 8:31135421-31135443 AGGCACTGTATTACATTTTGTGG + Intronic
1039190485 8:34968272-34968294 GGACACGGTAAGGGAATTTGTGG - Intergenic
1045293002 8:100850016-100850038 GGGCACCTTTATGCATTTTCTGG + Intergenic
1046555876 8:115772676-115772698 GGGGATGGCAGTGCATTTTGGGG - Intronic
1047667896 8:127112282-127112304 GGAGACAGAAATGCATTTTGAGG + Intergenic
1051527070 9:18057197-18057219 GTGCACAGTAATTCTTTTTGTGG - Intergenic
1054857956 9:69921641-69921663 TGGCAAGGAAATGTATTTTGGGG - Intergenic
1058384978 9:104425224-104425246 GGGCACGATAAAACTTTTTGTGG - Intergenic
1061508245 9:131044855-131044877 GGACACGGTGTTGCATTTAGTGG - Intronic
1186012872 X:5156578-5156600 TGGCAAGGAAATACATTTTGGGG - Intergenic
1187772001 X:22709589-22709611 GGGCACAGCAATGCATTTAATGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1195293429 X:103451347-103451369 GGGCAGGAAAATGCTTTTTGGGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1202232614 Y:22671585-22671607 GGGCACGGTAACGGATATGGTGG + Intergenic
1202310542 Y:23524573-23524595 GGGCACGGTAACGGATATGGTGG - Intergenic
1202560260 Y:26146021-26146043 GGGCACGGTAACGGATATGGTGG + Intergenic