ID: 1117896722

View in Genome Browser
Species Human (GRCh38)
Location 14:60495158-60495180
Sequence GGGCACGGTAATGCATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896716_1117896722 14 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896722 Original CRISPR GGGCACGGTAATGCATTTTG AGG Intronic