ID: 1117896723

View in Genome Browser
Species Human (GRCh38)
Location 14:60495159-60495181
Sequence GGCACGGTAATGCATTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117896716_1117896723 15 Left 1117896716 14:60495121-60495143 CCATAGATCTTACATTGGAACAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1117896723 14:60495159-60495181 GGCACGGTAATGCATTTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117896723 Original CRISPR GGCACGGTAATGCATTTTGA GGG Intronic
903845172 1:26275575-26275597 GGCCCAGGAATGCTTTTTGATGG + Intronic
905350479 1:37342860-37342882 GGTGTGGTTATGCATTTTGAAGG - Intergenic
906926397 1:50122189-50122211 GGCACTTTAATACATTTTCATGG - Intronic
909051987 1:70777196-70777218 GGCAGGTTAATGCAAATTGAGGG - Intergenic
916092782 1:161321230-161321252 GACATGTTAATGCATTTAGAAGG + Intronic
924664533 1:246057414-246057436 GGAACAGCAATGCATTTTAAGGG - Intronic
1068202568 10:53801240-53801262 GGCAAGGTAAAGAAATTTGATGG + Intergenic
1075743994 10:124713644-124713666 TGCTCTGTAATGCATTTTGAAGG + Intronic
1076310546 10:129503645-129503667 GCAACGAGAATGCATTTTGAAGG + Intronic
1078889166 11:15538565-15538587 GGCACAGAGATGCATTTTGCTGG - Intergenic
1080788160 11:35494682-35494704 GGCAGGGCAATGCATTTATAGGG - Intronic
1082999325 11:59277271-59277293 GGCATGGAAATGCATATTAAAGG + Intergenic
1086111884 11:83208161-83208183 GGCAAGGTGATGCATGTTGGTGG - Intronic
1087960970 11:104348636-104348658 GGGAAGGCAATGCATCTTGAAGG + Intergenic
1087984961 11:104666776-104666798 GGAACAGTCATGCATCTTGAGGG + Intergenic
1088909150 11:114177548-114177570 GGCCCGGGACTTCATTTTGAGGG + Intronic
1090168636 11:124578538-124578560 GGCACTGTAATGTTTTTTAAGGG + Intergenic
1092117901 12:6022530-6022552 GGCACAGAAAAGCATTTTGGAGG + Intronic
1099464495 12:82966380-82966402 GGCAGGGGAAAGCAGTTTGAAGG - Intronic
1099839133 12:87943973-87943995 GGCAAGCTAATGCAAATTGATGG + Intergenic
1103396209 12:120609170-120609192 GGCATGGGAATGGATTTTAAGGG + Intergenic
1103879007 12:124151694-124151716 GGCAGGTTAATGCAAATTGAGGG + Intronic
1114386917 14:22265233-22265255 GGCACTGTAGTACATTCTGAGGG - Intergenic
1116259351 14:42602983-42603005 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1117896723 14:60495159-60495181 GGCACGGTAATGCATTTTGAGGG + Intronic
1121187222 14:91984704-91984726 AGCAAGATAATGCATTTTAATGG + Intronic
1130368684 15:83264117-83264139 GGCATTGTAGTGGATTTTGAGGG + Exonic
1136663710 16:31789698-31789720 GGCCAGGAAAAGCATTTTGATGG + Intronic
1142945907 17:3426905-3426927 GGCACGGGAATGGATATTAAGGG - Intergenic
1146070618 17:29677679-29677701 GACACGCTAATTCATTTGGATGG - Exonic
1146087972 17:29847875-29847897 GGCAGGTTAATGCAAATTGAGGG - Intronic
1156125101 18:33895136-33895158 TTCACAGTAATGCATTTTTAAGG - Intronic
1156192344 18:34733993-34734015 GGCATGGGAATGGATTTTAAAGG - Intronic
1156537486 18:37878243-37878265 GGCATGGTAATGGATATTAAGGG + Intergenic
1160239224 18:77111226-77111248 GGCACGGTTCTGTATTTTGGAGG + Intronic
1168539663 19:57199637-57199659 GGCACGGGAATGGATATTAAGGG - Intronic
929893725 2:45939849-45939871 GGCCCGCTAATGCACTTTTAAGG + Intronic
937700156 2:124855009-124855031 GGCAAGGAAAAGCATTTGGAGGG + Intronic
939487052 2:142827380-142827402 GGTACTGTCATGCATTTTGATGG - Intergenic
939811402 2:146837417-146837439 GGCAAGGTTATGCTTTTTGGGGG - Intergenic
940357292 2:152757821-152757843 GGCAAAGCAATGCATTTTAATGG - Intronic
941148155 2:161879719-161879741 GGCACTTACATGCATTTTGAAGG - Intronic
941903213 2:170697185-170697207 GACATGGAAATGCAATTTGAGGG - Intergenic
944931636 2:204526177-204526199 GGCAGGCCAATGCATATTGATGG + Intergenic
948439510 2:237977680-237977702 GGCATGGCAAGGCACTTTGAGGG + Intronic
948659963 2:239500963-239500985 GCCACGTTAAAGCATTTTTAAGG + Intergenic
1171057867 20:21925241-21925263 GCCACTGTAATTCTTTTTGAGGG + Intergenic
1173730063 20:45322006-45322028 GGCACAATAATGCATTTAGAGGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1174847881 20:53961233-53961255 GGAATGTTAATGTATTTTGATGG + Intronic
1180205443 21:46256623-46256645 GGCACAGGGTTGCATTTTGAAGG - Intronic
1180332799 22:11547856-11547878 GGCACGCTAATGCCTTGGGAAGG - Intergenic
1180569336 22:16700944-16700966 GGCACAGAAAAGCATTTTGGAGG + Intergenic
1181099816 22:20531653-20531675 GGTACTGTCATGCATTTTGATGG - Intronic
1183626205 22:39003858-39003880 GCCACGGTAATGCTTTTTAGGGG - Intergenic
1184879086 22:47293775-47293797 GGGAAGGACATGCATTTTGAGGG + Intergenic
951384244 3:22025472-22025494 GGCATGGGAATGGATTTTAAGGG + Intronic
952758694 3:36894685-36894707 GGCAAGGTAATGGATTCTGTTGG - Intronic
954076226 3:48183268-48183290 GGCACTGTAATCCCTGTTGAGGG - Intronic
956295652 3:67710549-67710571 GGCACTGGAAAGAATTTTGATGG + Intergenic
958499547 3:94887863-94887885 GGCATGGAAATGGATATTGAGGG + Intergenic
966014114 3:175120047-175120069 AGCAAGGGAATGGATTTTGATGG + Intronic
969129109 4:4978084-4978106 GGCACGGTCAGGAATTCTGAGGG - Intergenic
971901397 4:32664234-32664256 GGCAAGATAAGACATTTTGATGG + Intergenic
972714226 4:41629770-41629792 GTCATGGTATTTCATTTTGAAGG + Intronic
978899371 4:113929127-113929149 GGCATGGGAATGCATATTAAGGG - Intronic
983540305 4:168902418-168902440 GGCACTGTGATTCATTATGATGG + Intronic
986955829 5:13148422-13148444 GGCACGGGAATGGATATTAAGGG - Intergenic
987325155 5:16805792-16805814 GGCAAGGGAATGTATTTTGGGGG - Intronic
987504111 5:18747575-18747597 GGCACGGGAATGAATATTAAGGG + Intergenic
987657412 5:20823924-20823946 GGCATGGGAATGGATATTGAGGG - Intergenic
987986652 5:25155696-25155718 GGCCAAGTAATGCATTTTTATGG + Intergenic
988080115 5:26403709-26403731 GGCACGGGAATGGATATTAAGGG - Intergenic
998301161 5:141022044-141022066 GGCACAGTGTTGAATTTTGATGG - Intergenic
999522789 5:152369685-152369707 GTCAGGGGAATGCATTTTAAAGG - Intergenic
1000730486 5:164828674-164828696 GGCACGGAAATGGATATTAAGGG + Intergenic
1008667968 6:53735602-53735624 GGAAAGGTAATGCCTTTTGAGGG + Intergenic
1009382305 6:63047327-63047349 GACATGGTAATGCATTTGGCAGG - Intergenic
1011396421 6:86914174-86914196 GGCAAGGTAACGCAATCTGATGG - Intergenic
1012612690 6:101235291-101235313 GACAGAGTTATGCATTTTGAAGG + Intergenic
1016961231 6:149674509-149674531 GGCATGGTAATGCATATTTGTGG - Intronic
1017849010 6:158286931-158286953 CGCACAGTAATGCTTTTGGAAGG + Intronic
1018335123 6:162778675-162778697 GGCAAGGAAATGCTTTTTGTTGG - Intronic
1022564004 7:31378617-31378639 GGCATGGTTATGCATTTTGTTGG - Intergenic
1024884644 7:54126930-54126952 GGCATGGTAATGGATATTAAGGG - Intergenic
1025831095 7:65050613-65050635 GGCATGGTAATGCACACTGATGG + Intergenic
1038836870 8:31135422-31135444 GGCACTGTATTACATTTTGTGGG + Intronic
1043260254 8:78186440-78186462 GGCATGGGAATGCATATTAAGGG - Intergenic
1045330284 8:101150124-101150146 GGGACGGTCTTGCATTTTAAAGG - Intergenic
1045835305 8:106513596-106513618 GGGACTGCACTGCATTTTGAAGG - Intronic
1047962354 8:130019938-130019960 AGCAGGGAAATGCATTTTGGAGG - Intergenic
1049129981 8:140830051-140830073 TGCATGTTAGTGCATTTTGAAGG - Intronic
1057680953 9:97184139-97184161 GGCATTGTAATGAATTTTAAAGG + Intergenic
1188422631 X:30008479-30008501 GATACAGTGATGCATTTTGATGG + Intergenic
1189706152 X:43760757-43760779 GGCAAGGAAATGGATTTTCAAGG + Intergenic
1190953318 X:55167454-55167476 GGCAGGTTAATGCAAGTTGAGGG - Intronic
1194604688 X:95964276-95964298 GGCATGGTAATGGATATTAAGGG - Intergenic
1195389222 X:104343690-104343712 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1196810574 X:119625957-119625979 GTCACGGTAGTGAGTTTTGAGGG - Intronic