ID: 1117897423

View in Genome Browser
Species Human (GRCh38)
Location 14:60502175-60502197
Sequence ACTCAATTTCTGAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 5, 3: 8, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117897423_1117897426 27 Left 1117897423 14:60502175-60502197 CCATCTACCTTCAGAAATTGAGT 0: 1
1: 0
2: 5
3: 8
4: 162
Right 1117897426 14:60502225-60502247 TAACAAGGCTTAGTCTAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1117897423_1117897425 12 Left 1117897423 14:60502175-60502197 CCATCTACCTTCAGAAATTGAGT 0: 1
1: 0
2: 5
3: 8
4: 162
Right 1117897425 14:60502210-60502232 TCTATCTCACAGTTTTAACAAGG 0: 1
1: 0
2: 1
3: 20
4: 183
1117897423_1117897427 30 Left 1117897423 14:60502175-60502197 CCATCTACCTTCAGAAATTGAGT 0: 1
1: 0
2: 5
3: 8
4: 162
Right 1117897427 14:60502228-60502250 CAAGGCTTAGTCTAGTGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117897423 Original CRISPR ACTCAATTTCTGAAGGTAGA TGG (reversed) Intronic
902035585 1:13455757-13455779 GGTCATTTTCTTAAGGTAGATGG + Intergenic
902737649 1:18411856-18411878 ACGCAATTTGTGAAGGGGGAAGG - Intergenic
904129811 1:28267294-28267316 ACTCCCTTTTTGAAGGTAGCTGG + Intronic
908851794 1:68384309-68384331 AATCACTTCCTGAAGTTAGAAGG - Intergenic
915859324 1:159426478-159426500 ACTCCATTTATGAATGTATAAGG + Intergenic
916585543 1:166146684-166146706 GCTCAAATTCAGAAGGCAGAGGG + Intronic
919582963 1:199400350-199400372 ACTCATTCTCTGAAGGTAGATGG - Intergenic
920351491 1:205340940-205340962 TCCCAATTTGTGAAGGAAGATGG - Intronic
924687994 1:246315772-246315794 AATCAACTTTTGAAGATAGAAGG + Intronic
924736341 1:246760494-246760516 ACACAATTTCTGGAGCTAAATGG - Intronic
1063153170 10:3355132-3355154 ACTCCATCTCTGAAGGCAGGGGG - Intergenic
1063819236 10:9815555-9815577 ATTAAATTTCAGAAAGTAGATGG - Intergenic
1066514027 10:36135441-36135463 ACTTAATTTCTGAGGCTAGTAGG + Intergenic
1069473855 10:68716107-68716129 ACCCAGTTTCTGAATCTAGAGGG + Intergenic
1071791448 10:88958517-88958539 ACTCAATTTCTGGTGTCAGATGG - Intronic
1077961283 11:7078922-7078944 ACTCAATCCCTGAAGATAGCAGG + Intergenic
1078969951 11:16397638-16397660 AATCAATTTATGAAGGTAGAAGG + Intronic
1080686643 11:34521347-34521369 TCTCAATGTGTGAAGGGAGATGG + Intergenic
1081008674 11:37780898-37780920 ACTCATTTTAAGAAGGAAGAAGG + Intergenic
1081097124 11:38950929-38950951 ACTCTATTGCTGAAAATAGAAGG + Intergenic
1081130056 11:39368509-39368531 ACTTAATTTCCCAAGGTACATGG - Intergenic
1085893936 11:80614188-80614210 ATTCAATTATTGAAGGTAAAAGG - Intergenic
1086632923 11:89045720-89045742 ACTGATCTTCTGAAGCTAGAAGG + Intronic
1088209741 11:107442210-107442232 ACTCACTTTCTCACAGTAGAAGG + Intronic
1088647621 11:111929223-111929245 ACTCAGTTTCTGAGGATAGAAGG + Intronic
1089728009 11:120500046-120500068 ACTGCATCTCTGAAGGTGGAGGG - Intergenic
1092954993 12:13541519-13541541 ACTCTATTTAGGAAGGAAGAGGG - Exonic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1096003469 12:48149047-48149069 ACTAAATTTCTCTAGGAAGATGG - Exonic
1099287245 12:80729395-80729417 ACAAAATTTCAGAAGGTAGATGG - Intergenic
1100760885 12:97805412-97805434 AATTATTTTCTGAATGTAGAAGG - Intergenic
1102585586 12:113920530-113920552 ACTCAATTTCAGAGGGCTGACGG + Intronic
1105445609 13:20453583-20453605 TTTCAGTTTCTGAAGATAGAGGG - Intronic
1106750196 13:32756251-32756273 ACACAGTTTCAGAAGGAAGAAGG - Intronic
1106998815 13:35520641-35520663 AATCAATTCCTGAAGCTAGTTGG - Intronic
1107535246 13:41323209-41323231 ACTCCATTTATGAAGGTAGAAGG - Intronic
1107553285 13:41496410-41496432 AGTCCCTTTCTGAAGGCAGAGGG + Intergenic
1110450228 13:75632450-75632472 ACTCAATAAATGAAGGTTGAAGG - Intronic
1111311625 13:86495173-86495195 TCTCAATTTCTTTAGGTGGAAGG + Intergenic
1112742350 13:102489519-102489541 ACTGACTTTCTAAAGGTAAACGG + Intergenic
1115302535 14:31900736-31900758 ACTCACTTCCTGGAGTTAGAAGG + Intergenic
1115421759 14:33203277-33203299 ACTTAATTTCTGAGGCTAGTAGG + Intronic
1117897423 14:60502175-60502197 ACTCAATTTCTGAAGGTAGATGG - Intronic
1120213770 14:81660283-81660305 ACTGAATTCCAGAGGGTAGAAGG + Intergenic
1121146291 14:91585467-91585489 ACTCAATTGCTGAATGGATATGG - Intronic
1123811879 15:23935214-23935236 ACTCAATAGCAGAAGGTAAAGGG - Intergenic
1125264413 15:37862885-37862907 ACATACTTTCTGATGGTAGAAGG - Intergenic
1125347702 15:38734737-38734759 CCTCAATTTCTCAATGTAGTTGG + Intergenic
1126851950 15:52802478-52802500 TATCAATTTCTGGAGGCAGAAGG + Intergenic
1129898406 15:79125887-79125909 TGTCAATTTCAGAAGTTAGATGG + Intergenic
1132227480 15:100153725-100153747 TCTCAATTTCTAAAGGCAGATGG + Intronic
1132700907 16:1221707-1221729 ACTCAGCTTCTCAAGGGAGAGGG + Exonic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143805515 17:9422812-9422834 TCGCCACTTCTGAAGGTAGATGG - Intronic
1143861592 17:9895219-9895241 ACTCAATATCTGATGCCAGAAGG - Intergenic
1146429867 17:32782469-32782491 ATTCAATGTCCGAGGGTAGAGGG - Intronic
1147762611 17:42809350-42809372 TCTCTATTTCTGAAGGTTGTGGG + Exonic
1149208676 17:54278581-54278603 ACTCTGTCACTGAAGGTAGATGG - Intergenic
1155528692 18:26743854-26743876 ACACAGTTTCTGAATTTAGAAGG + Intergenic
1156329593 18:36107211-36107233 ACAGAAATTCTGAAGGTAGAAGG - Intergenic
1156806256 18:41185792-41185814 ACTAAATCTCTGTAGGCAGAGGG + Intergenic
1158234620 18:55299843-55299865 ACTAAATTTGTGATGGTAGGGGG - Intronic
1159657927 18:71055205-71055227 ATTCACTTTCTGAAGGTGGATGG - Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1167705918 19:51081176-51081198 CCTGAGTTTCTGAATGTAGACGG + Intronic
925167029 2:1722367-1722389 TCTCAATTTCTCATGGGAGAGGG - Intronic
926447571 2:12962533-12962555 AGGCAATTTCAGAAGGTATAAGG + Intergenic
926749127 2:16184602-16184624 ACTAAATTACTGAATGCAGATGG - Intergenic
928439406 2:31279349-31279371 ACTCAACTTCAGCAGGCAGAGGG - Intergenic
935609600 2:105007332-105007354 AATCTGTTTCTGAAGTTAGAGGG - Intergenic
936652486 2:114444644-114444666 ACTCAATGGCTGCAGTTAGAAGG - Intronic
937124857 2:119467608-119467630 AATCAATTCCTGAAGGTAGAAGG - Intronic
939368832 2:141270847-141270869 AAAAAATTTCTGAAGATAGATGG + Intronic
939536377 2:143435627-143435649 AGTCAATATCTGACTGTAGAAGG - Exonic
940561514 2:155302830-155302852 TCTCATTTTCTGTAGCTAGAAGG - Intergenic
942920038 2:181362045-181362067 ACTGACTTTCTGGAGCTAGAGGG + Intergenic
943851719 2:192731464-192731486 ACTCAATTTAACAGGGTAGAGGG - Intergenic
944622710 2:201533449-201533471 ACTTAAATTCTAAATGTAGAGGG - Intronic
944880432 2:204007555-204007577 ACTCCAATTCTGATGGTAGAGGG + Intergenic
945642960 2:212453354-212453376 TCTCCATTTTTGAAGGCAGAAGG - Intronic
946467726 2:219927189-219927211 GCTCACTTTCTGCAGGGAGATGG + Intergenic
946595544 2:221302049-221302071 ACTCATTTCTTGAAGGTGGAGGG - Intergenic
1170028787 20:11922010-11922032 TCTTGAATTCTGAAGGTAGAAGG + Intronic
1177802540 21:25842030-25842052 ACAGAATCTCTGAGGGTAGATGG + Intergenic
1178122560 21:29484035-29484057 ACTCCACTTCTGATGTTAGAAGG - Intronic
1181329544 22:22079346-22079368 ACCCTATTTCTGAAGGTAATTGG + Intergenic
1184857034 22:47151929-47151951 TCTCAGCTTCTGAAGATAGAAGG + Intronic
949752538 3:7371253-7371275 GCTCAAATTCTGAAGTTAGCTGG + Intronic
951131880 3:19056246-19056268 ACTTAATTTCTTGTGGTAGAAGG - Intergenic
951454892 3:22879662-22879684 TTTCAGTTTCTTAAGGTAGAAGG - Intergenic
957619369 3:82574912-82574934 ACTGTATTTATGATGGTAGAAGG + Intergenic
958878981 3:99647976-99647998 ACTTATTTTCTGAAAGCAGAGGG - Intronic
959574450 3:107919330-107919352 ATGCAATTTCAGAAGGTAGAAGG + Intergenic
959858055 3:111184365-111184387 AATCTATTAATGAAGGTAGAAGG - Intronic
964957898 3:162383781-162383803 CCTCAATTTCTGCTGGTACAGGG - Intergenic
965214125 3:165838912-165838934 ACTCAATTTCTGCAAGAAAATGG + Intergenic
966220405 3:177545712-177545734 ACTCTATGTCTGAAGGCAGGTGG - Intergenic
966786939 3:183630726-183630748 ACTCTATTCCTGAAAGGAGAGGG + Intergenic
967024291 3:185550295-185550317 AATAAACTTCTGTAGGTAGAAGG - Intronic
970056224 4:11975946-11975968 ACTAAATTTCTAAAGGGAAAAGG + Intergenic
971466221 4:26964863-26964885 ACTTAACTTCTGTAGGTGGATGG - Intronic
973056780 4:45669317-45669339 AGGCAATTTCTGTAGATAGAGGG - Intergenic
975447323 4:74481046-74481068 TCTGAATTTCTCAGGGTAGACGG + Intergenic
977209255 4:94199346-94199368 TCTTAATTTGGGAAGGTAGAGGG - Intergenic
978841034 4:113212560-113212582 ACGCAAATTCTGAAGCTAGGTGG + Intronic
979030329 4:115635280-115635302 ATTCAACTTCTGATGGTAGTTGG - Intergenic
980396376 4:132221470-132221492 ACTCAAATTCTGTAGCCAGAAGG + Intergenic
981311514 4:143302277-143302299 ACACAATTTCTGGAGGTTGGCGG - Intergenic
981688164 4:147478455-147478477 ACTCATTTTATGAATTTAGAGGG + Intergenic
982092124 4:151889339-151889361 ACTCAGATTCTGCAGGTAGTCGG - Intergenic
982700455 4:158655296-158655318 ACTCTATTTCAGGAGGTCGAAGG - Intergenic
983993614 4:174153590-174153612 AATCACTTTCTGAATGTGGATGG - Intergenic
984340013 4:178445219-178445241 GCTCAATTTTTGAAGTTAGTAGG + Intergenic
987651964 5:20753015-20753037 ACCAATTTTCTGAAGATAGAAGG + Intergenic
987850209 5:23341889-23341911 AATCAATTTCTTAAGGTTTATGG + Intergenic
988647047 5:33105974-33105996 ACTTAAATTCAGAAGGTAAATGG - Intergenic
988743599 5:34108463-34108485 ACCAATTTTCTGAAGATAGAAGG - Intronic
988846447 5:35132680-35132702 CCTAAATTTCTCAAGGCAGAAGG + Intronic
989394392 5:40938144-40938166 ATTCTATTTCTTAAGGCAGATGG - Intronic
990272024 5:54152519-54152541 ACACAGTGTCTGAAGGAAGAGGG - Intronic
994777454 5:104052065-104052087 ATTCAATTTCTGAAGAGAGAGGG + Intergenic
995254482 5:110030686-110030708 TGGCAATTTCTGAAGGTAGGTGG - Intergenic
996367942 5:122722716-122722738 ATTCTATTTCTAAAGGAAGATGG - Intergenic
996974261 5:129411620-129411642 ATTCTATTTCTGAATGTATAAGG + Intergenic
997036005 5:130192547-130192569 AAAGAATCTCTGAAGGTAGATGG - Intergenic
999335506 5:150712768-150712790 ACTTAGTTTCTGAAAGTAAAAGG + Intronic
1000281335 5:159784922-159784944 ACTCAATTTCAGATGCTAAATGG - Intergenic
1001728254 5:173926796-173926818 ATTTAATTTCTAAAGGGAGAAGG - Intronic
1002990132 6:2230887-2230909 AGTGAATTTCTCAAGGTGGATGG - Intronic
1003047659 6:2748765-2748787 ACTCAAGATCTGAAGGAAAAAGG + Intronic
1005906636 6:30266650-30266672 ATTCAGTTGCTGGAGGTAGAGGG + Intergenic
1008408462 6:51145164-51145186 AATCAATGCCTGAAGGCAGAGGG - Intergenic
1010196996 6:73249707-73249729 AATAACTTTCTGATGGTAGAGGG + Intronic
1011168424 6:84477529-84477551 TTTTAATTTTTGAAGGTAGAAGG - Intergenic
1011319121 6:86070430-86070452 TCCCAATTTCTCAAGGAAGAGGG - Intergenic
1012464960 6:99506772-99506794 GGTCATTTTCTGAAGGGAGAGGG - Intronic
1012600696 6:101093025-101093047 TCTGAATTTCATAAGGTAGAAGG - Intergenic
1014173795 6:118309119-118309141 ATGCAATTTCAGAAGGCAGATGG + Intronic
1016169070 6:140986253-140986275 ACTAAGTTTCTGAAAGAAGATGG - Intergenic
1017343583 6:153354785-153354807 ATTCAATTTCTGATTGTATATGG + Intergenic
1021153314 7:17178611-17178633 AATCAATTCCTAAAGGCAGAGGG + Intergenic
1022960283 7:35419475-35419497 ACTCACTTACTGAAGCTAAAAGG + Intergenic
1024268310 7:47623162-47623184 GCTCAATTTCTGAAGGAAACAGG + Intergenic
1029880476 7:103803651-103803673 ACTCAGCTTCTAAGGGTAGAAGG + Intronic
1030861194 7:114631774-114631796 ACAAAATTTCTCAAGGTATAAGG - Intronic
1032029089 7:128467559-128467581 ACTCAGTCACTGAAGCTAGAAGG + Intergenic
1032246894 7:130221007-130221029 AATCATTATCTGAAGATAGAAGG + Intergenic
1034004538 7:147455119-147455141 ACACCATATCTGAAAGTAGAAGG + Intronic
1036159391 8:6372414-6372436 AATCCAGTACTGAAGGTAGAGGG + Intergenic
1036775326 8:11607928-11607950 GCTGAATTTCTGACGGGAGATGG - Intergenic
1042032001 8:64486539-64486561 ACCCAATTACTGAAGGTAGAGGG + Intergenic
1043792614 8:84491812-84491834 ACTCAATTTCTAAATTGAGAAGG + Intronic
1045799350 8:106083923-106083945 ACAATATATCTGAAGGTAGATGG - Intergenic
1048084946 8:131167299-131167321 ACTCAATTGCAGAAAGTACATGG - Intergenic
1048398326 8:134036812-134036834 TCTCATTTTCTGAAGGTTTAGGG - Intergenic
1050514394 9:6427919-6427941 ACTAATTTTCTGAAGCAAGATGG + Intronic
1051399914 9:16669679-16669701 TCTCTATTTGTGCAGGTAGATGG - Intronic
1055368786 9:75574435-75574457 ATTCTATTTGTCAAGGTAGAAGG + Intergenic
1055369746 9:75584426-75584448 ACTCAGTAGCTGAAGGCAGATGG + Intergenic
1056989956 9:91401411-91401433 ACTCACTTTTTCCAGGTAGAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057498762 9:95580644-95580666 AATCAATTTCAAAAGGTAAAAGG - Intergenic
1059621368 9:116009319-116009341 AATCAAGTTCTGAAGATGGATGG - Intergenic
1060271031 9:122141735-122141757 TCTCAATTTCAGTAGGTAAAAGG - Intergenic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1061173471 9:128976686-128976708 ACTCAATTTCTAAAGGTCATGGG + Intronic
1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG + Intergenic
1186605237 X:11083002-11083024 ACTCAATTTTTGAAGGAGGTGGG + Intergenic
1187603142 X:20855007-20855029 TCTCAAATTCTCAAGGAAGAGGG - Intergenic
1188720496 X:33517507-33517529 ATTGAATTTCTGAAGGTGGGTGG - Intergenic
1188756252 X:33968201-33968223 ACTCCATCACTGATGGTAGATGG + Intergenic
1190639553 X:52470292-52470314 AATCAGTTTCTGAAAGTAAATGG + Intergenic
1196195295 X:112832911-112832933 AGTCACTCTCTGAAGGCAGAAGG + Intronic
1197975957 X:132166205-132166227 AATCAATTACTGAAGTTACAGGG + Intergenic
1198672641 X:139097929-139097951 ACTCTATTTCTCAAGCTATATGG + Intronic
1198884143 X:141315288-141315310 ACTCATTTTCTGAATGTTCAAGG - Intergenic